Gene Page: MPP7

Summary
GeneID  143098
Symbol  MPP7
Synonyms  FLJ32798
Description  membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
See related  HGNC:26542|MIM:610973|Ensembl:ENSG00000150054|HPRD:14733|
Locus tag  RP11-218D6.5
Gene type  protein-coding
Map location  10p11.23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionIEABrain (GO term level: 10)-
GO:0016020membraneIEA-
GO:0030054cell junctionIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/206147714841A,m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-409-3p14761482m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
miR-496148314901A,m8hsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.