Gene Page: UNC45B

Summary
GeneID  146862
Symbol  UNC45B
Synonyms  CMYA4|FLJ38610|MGC119540|MGC119541|SMUNC45|UNC45
Description  unc-45 homolog B (C. elegans)
See related  HGNC:14304|MIM:611220|Ensembl:ENSG00000141161|HPRD:10840|
Locus tag  -
Gene type  protein-coding
Map location  17q12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007519skeletal muscle developmentIEAneuron (GO term level: 8)-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-324-5p1420m8hsa-miR-324-5pCGCAUCCCCUAGGGCAUUGGUGU
miR-329373379m8hsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-3381723m8hsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.