Gene Page: SYT6

Summary
GeneID  148281
Symbol  SYT6
Synonyms  -
Description  synaptotagmin VI
See related  HGNC:18638|MIM:607718|Ensembl:ENSG00000134207|HPRD:09654|
Locus tag  RP5-1037B23.1
Gene type  protein-coding
Map location  1p13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005215transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006810transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0008021synaptic vesicleIEASynap, Neurotransmitter (GO term level: 12)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0030054cell junctionIEA-
GO:0031410cytoplasmic vesicleIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NRXN1DKFZp313P2036 | FLJ35941 | Hs.22998 | KIAA0578neurexin 1-HPRD8901523 
SYT6-synaptotagmin VIAffinity Capture-WesternBioGRID10531343 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/10715221A,m8hsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-140103109m8hsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-142-5p9679731Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-3209659711Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-49512151221m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-542-3p279528011Ahsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.