Gene Page: IGSF11

Summary
GeneID  152404
Symbol  IGSF11
Synonyms  BT-IgSF|CXADRL1|Igsf13|MGC35227|VSIG3
Description  immunoglobulin superfamily, member 11
See related  HGNC:16669|MIM:608351|Ensembl:ENSG00000144847|HPRD:16321|
Locus tag  -
Gene type  protein-coding
Map location  3q13.32
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001558regulation of cell growthIEA-
GO:0007155cell adhesionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-18117431749m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-18618441850m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-339153715431Ahsa-miR-339UCCCUGUCCUCCAGGAGCUCA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.