Gene Page: SLC36A2

Summary
GeneID  153201
Symbol  SLC36A2
Synonyms  FLJ16051|MGC119658|MGC119660|PAT2|TRAMD1
Description  solute carrier family 36 (proton/amino acid symporter), member 2
See related  HGNC:18762|MIM:608331|Ensembl:ENSG00000186335|HPRD:12215|
Locus tag  -
Gene type  protein-coding
Map location  5q33.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01718 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00459 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005280hydrogen:amino acid symporter activityIEA-
GO:0015193L-proline transmembrane transporter activityIEA-
GO:0015187glycine transmembrane transporter activityIEA-
GO:0015180L-alanine transmembrane transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0015816glycine transportIEA-
GO:0015824proline transportIEA-
GO:0015808L-alanine transportIEA-
GO:0015992proton transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-380-5p169817041Ahsa-miR-380-5pUGGUUGACCAUAGAACAUGCGC
hsa-miR-563AGGUUGACAUACGUUUCCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.