Gene Page: TXLNB

Summary
GeneID  167838
Symbol  TXLNB
Synonyms  C6orf198|DKFZp451A175|LST001|MDP77|dJ522B19.2
Description  taxilin beta
See related  HGNC:21617|MIM:611438|Ensembl:ENSG00000164440|HPRD:10793|
Locus tag  RP3-522B19.2
Gene type  protein-coding
Map location  6q24.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIDA11256614 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
STX1AHPC-1 | STX1 | p35-1syntaxin 1A (brain)-HPRD,BioGRID15184072 
STX4STX4A | p35-2syntaxin 4-HPRD,BioGRID15184072 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-369-3p185818641Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-374185818651A,m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-409-3p191619231A,m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
miR-54322472253m8hsa-miR-543AAACAUUCGCGGUGCACUUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.