Gene Page: ATN1

Summary
GeneID  1822
Symbol  ATN1
Synonyms  B37|D12S755E|DRPLA|NOD
Description  atrophin 1
See related  HGNC:3033|MIM:607462|Ensembl:ENSG00000111676|HPRD:06311|
Locus tag  -
Gene type  protein-coding
Map location  12p13.31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.2088 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003714transcription corepressor activityIEA-
GO:0005515protein bindingIEA-
GO:0019904protein domain specific bindingIPI11984006 
GO:0050827toxin receptor bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007417central nervous system developmentTASBrain (GO term level: 6)7647802 
GO:0000122negative regulation of transcription from RNA polymerase II promoterIEA-
GO:0008219cell deathIEA-
GO:0009404toxin metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusTAS10814707 
GO:0005737cytoplasmIEA-
GO:0005737cytoplasmTAS7647802 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ATRXATR2 | MGC2094 | MRXHF1 | RAD54 | RAD54L | SFM1 | SHS | XH2 | XNP | ZNF-HXalpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)-HPRD14645126 
BAIAP2BAP2 | IRSP53BAI1-associated protein 2-HPRD,BioGRID10332026 
CASP1ICE | IL1BC | P45caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)Atrophin-1 interacts with caspase 1. This interaction was modeled on a demonstrated interaction between human atrophin-1 and caspase 1 from an unspecified species.BIND9535906 
CASP3CPP32 | CPP32B | SCA-1caspase 3, apoptosis-related cysteine peptidaseAtrophin-1 interacts with caspase 3. This interaction was modeled on a demonstrated interaction between human atrophin-1 and caspase 3 from an unspecified species.BIND9535906 
CASP7CMH-1 | ICE-LAP3 | MCH3caspase 7, apoptosis-related cysteine peptidaseAtrophin-1 interacts with caspase 7.BIND9535906 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidaseAtrophin-1 interacts with caspase 8.BIND9535906 
CTNND2GT24 | NPRAPcatenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)Two-hybridBioGRID10332026 
DVL1DVL | MGC54245dishevelled, dsh homolog 1 (Drosophila)Two-hybridBioGRID10332026 
ITCHAIF4 | AIP4 | NAPP1 | dJ468O1.1itchy E3 ubiquitin protein ligase homolog (mouse)-HPRD,BioGRID9647693 
Atrophin-1 interacts with AIP4.BIND9647693 
LYSTCHS | CHS1lysosomal trafficking regulator-HPRD,BioGRID11984006 
MAGI1AIP3 | BAIAP1 | BAP1 | MAGI-1 | TNRC19 | WWP3membrane associated guanylate kinase, WW and PDZ domain containing 1Atrophin-1 interacts with AIP-3.BIND9647693 
-HPRD,BioGRID9647693 
MAGI2ACVRIP1 | AIP1 | ARIP1 | MAGI-2 | SSCAMmembrane associated guanylate kinase, WW and PDZ domain containing 2Atrophin-1 interacts with AIP1.BIND9647693 
-HPRD9647693 
MYST2HBO1 | HBOA | KAT7MYST histone acetyltransferase 2Two-hybridBioGRID16169070 
PDCD6IPAIP1 | Alix | DRIP4 | HP95 | MGC17003programmed cell death 6 interacting protein-HPRD,BioGRID9647693 
REREARG | ARP | ATN1L | DNB1 | FLJ38775 | KIAA0458arginine-glutamic acid dipeptide (RE) repeats-HPRD,BioGRID10814707 
TLE1ESG | ESG1 | GRG1transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)Two-hybridBioGRID16169070 
VIMFLJ36605vimentinTwo-hybridBioGRID16169070 
WWP1AIP5 | DKFZp434D2111 | Tiul1 | hSDRP1WW domain containing E3 ubiquitin protein ligase 1-HPRD,BioGRID9647693 
Atrophin-1 interacts with AIP-5.BIND9647693 
WWP2AIP2 | WWp2-likeWW domain containing E3 ubiquitin protein ligase 2Atrophin-1 interacts with AIP2.BIND9647693 
-HPRD,BioGRID9647693 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4104534591Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.