Gene Page: E2F1

Summary
GeneID  1869
Symbol  E2F1
Synonyms  E2F-1|RBAP1|RBBP3|RBP3
Description  E2F transcription factor 1
See related  HGNC:3113|MIM:189971|Ensembl:ENSG00000101412|HPRD:01806|
Locus tag  -
Gene type  protein-coding
Map location  20q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIDA15731768 
GO:0003700transcription factor activityTAS11418595 
GO:0003714transcription corepressor activityTAS10199402 
GO:0005515protein bindingIPI11418595 |11486038 
GO:0016563transcription activator activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0030900forebrain developmentIEABrain (GO term level: 8)-
GO:0000080G1 phase of mitotic cell cycleTAS10199402 
GO:0000122negative regulation of transcription from RNA polymerase II promoterTAS10199402 
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0008283cell proliferationTAS10199402 
GO:0006915apoptosisTAS8653790 
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
GO:0051726regulation of cell cycleIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005654nucleoplasmEXP9190208 
GO:0005667transcription factor complexIEA-
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARID3ABRIGHT | DRIL1 | DRIL3 | E2FBP1AT rich interactive domain 3A (BRIGHT-like)-HPRD,BioGRID9780002 
ARID4ARBBP1 | RBP-1 | RBP1AT rich interactive domain 4A (RBP1-like)-HPRD10321733 
BARD1-BRCA1 associated RING domain 1E2F1 interacts with the BARD1 promoter.BIND11799067 
BIRC5API4 | EPR-1baculoviral IAP repeat-containing 5E2F1 (E2F-1) interacts with the BIRC5 (survivin) promoter.BIND15271987 
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onsetBRCA1 associates with E2F-1BIND9244350 
-HPRD9244350 
BRD2D6S113E | DKFZp686N0336 | FLJ31942 | FSH | FSRG1 | KIAA9001 | NAT | RING3 | RNF3bromodomain containing 2-HPRD,BioGRID10965846 
CBX5HP1 | HP1Achromobox homolog 5 (HP1 alpha homolog, Drosophila)E2F1 interacts with HP1-alpha chromatin.BIND11799066 
CCDC76FLJ10287 | FLJ11219coiled-coil domain containing 76E2F1 interacts with the FLJ10287 chromatin.BIND11799066 
CCNA1-cyclin A1cyclin A1 interacts with E2F-1.BIND10022926 
Affinity Capture-Western
Reconstituted Complex
BioGRID10022926 
CCNA2CCN1 | CCNAcyclin A2E2F interacts with the CycA promoter and 5-prime UTR.BIND15306814 
-HPRD,BioGRID12501191 
CDC2CDC28A | CDK1 | DKFZp686L20222 | MGC111195cell division cycle 2, G1 to S and G2 to ME2F1 interacts with the Cdc2 promoter.BIND10766737 
CDC25ACDC25A2cell division cycle 25 homolog A (S. pombe)E2F1 interacts with the Cdc25A promoter region.BIND10766737 
CDC6CDC18L | HsCDC18 | HsCDC6cell division cycle 6 homolog (S. cerevisiae)E2F1 interacts with the Cdc6 promoter region.BIND10766737 
CDK2p33(CDK2)cyclin-dependent kinase 2-HPRD,BioGRID7969176 
CDK3-cyclin-dependent kinase 3-HPRD,BioGRID8846921 |11733001 
CDK7CAK1 | CDKN7 | MO15 | STK1 | p39MO15cyclin-dependent kinase 7Affinity Capture-WesternBioGRID10428966 
CDKN2AARF | CDK4I | CDKN2 | CMM2 | INK4 | INK4a | MLM | MTS1 | TP16 | p14 | p14ARF | p16 | p16INK4 | p16INK4a | p19cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)p14ARF interacts with E2F-1.BIND12082609 
CEBPDC/EBP-delta | CELF | CRP3 | NF-IL6-betaCCAAT/enhancer binding protein (C/EBP), deltaC/EBP-delta interacts with E2F1.BIND15674331 
CEBPEC/EBP-epsilon | CRP1CCAAT/enhancer binding protein (C/EBP), epsilonE2F-1 interacts with C/EBPepsilon.BIND12947005 
CHEK1CHK1CHK1 checkpoint homolog (S. pombe)E2F1 interacts with the Chk1 promoter.BIND11799067 
CREBBPCBP | KAT3A | RSTSCREB binding proteinTwo-hybridBioGRID12748276 
CSDACSDA1 | DBPA | ZONABcold shock domain protein AE2F1 interacts with the DBPA chromatin.BIND11799066 
CTDP1CCFDN | FCP1CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1-HPRD14576433 
CUL1MGC149834 | MGC149835cullin 1-HPRD,BioGRID10559858 
DNMT1AIM | CXXC9 | DNMT | FLJ16293 | MCMT | MGC104992DNA (cytosine-5-)-methyltransferase 1Co-fractionationBioGRID10888886 
E2F1E2F-1 | RBAP1 | RBBP3 | RBP3E2F transcription factor 1E2F1 interacts with the E2F1 promoter region.BIND10766737 
E2F2E2F-2E2F transcription factor 2E2F2 interacts with the E2F1 promoter region.BIND10766737 
E2F4E2F-4E2F transcription factor 4, p107/p130-bindingE2F4 interacts with the E2F1 promoter region.BIND10766737 
E2F6E2F-6 | MGC111545E2F transcription factor 6-HPRD9689056 
EAPPBM036 | C14orf11 | FLJ20578 | MGC4957E2F-associated phosphoproteinE2F1 interacts with EAPP.BIND15716352 
FHL2AAG11 | DRAL | SLIM3four and a half LIM domains 2Two-hybridBioGRID12411495 
E2F1 interacts with a molecule expressed by Gene FHL2. The precise molecular variant of FHL2 involved in this interaction is not specified.BIND12411495 
GAB2KIAA0571GRB2-associated binding protein 2The Gab2 promoter region interacts with E2F1.BIND15574337 
GAS2L1GAR22 | MGC17243growth arrest-specific 2 like 1E2F1 interacts with the GAR22 chromatin.BIND11799066 
GTF2H1BTF2 | TFB1 | TFIIHgeneral transcription factor IIH, polypeptide 1, 62kDa-HPRD,BioGRID10428966 
HDAC1DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1histone deacetylase 1Affinity Capture-WesternBioGRID10734134 
HIST1H2AGH2A.1b | H2A/p | H2AFP | pH2A/fhistone cluster 1, H2agE2F1 interacts with the H2A chromatin.BIND11799066 
HIST1H2BJH2B/r | H2BFRhistone cluster 1, H2bjE2F1 interacts with the H2B chromatin.BIND11799066 
HIST2H4AFO108 | H4 | H4/n | H4F2 | H4FN | HIST2H4histone cluster 2, H4aE2F1 interacts with the H4F2 chromatin.BIND11799066 
JMYFLJ37870 | MGC163496junction-mediating and regulatory proteinE2F1 interacts with the JMY promoter.BIND15706352 
MAD2L1HSMAD2 | MAD2MAD2 mitotic arrest deficient-like 1 (yeast)E2F1 interacts with the MAD2 promoter.BIND11799067 
E2F interacts with the MAD2 promoter and 5-prime UTR.BIND15306814 
MDM4DKFZp781B1423 | HDMX | MDMX | MGC132766 | MRP1Mdm4 p53 binding protein homolog (mouse)-HPRD,BioGRID12532331 
E2F-1 interacts with MDMX. This interaction was modeled on a demonstrated interaction between human E2F-1 and mouse MDMX.BIND12532331 
MFAP1-microfibrillar-associated protein 1E2F1 interacts with MFAP1 chromatin.BIND11799066 
MGAFLJ12634 | KIAA0518 | MAD5 | MXD5MAX gene associatedTwo-hybridBioGRID12748276 
MLH1COCA2 | FCC2 | HNPCC | HNPCC2 | MGC5172 | hMLH1mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)E2F1 interacts with the MLH1 promoter.BIND11799067 
MSH2COCA1 | FCC1 | HNPCC | HNPCC1 | LCFS2mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)E2F1 interacts with the MSH2 promoter.BIND11799067 
The 5'MSH2 promoter region interacts with E2F1.BIND15619620 
MT1GMGC12386 | MT1 | MT1Kmetallothionein 1GE2F1 interacts with the MT1G promoter.BIND15735762 
MYBL2B-MYB | BMYB | MGC15600v-myb myeloblastosis viral oncogene homolog (avian)-like 2Two-hybridBioGRID12748276 
E2F1 interacts with the B-myb promoter region.BIND10766737 
MYCbHLHe39 | c-Mycv-myc myelocytomatosis viral oncogene homolog (avian)E2F-1 interacts with the MYC gene P2 promoter region.BIND7892279 
NCOA3ACTR | AIB-1 | AIB1 | CAGH16 | CTG26 | KAT13B | MGC141848 | RAC3 | SRC3 | TNRC14 | TNRC16 | TRAM-1 | pCIPnuclear receptor coactivator 3ACTR interacts with E2F1.BIND15169882 
NCOA6AIB3 | ANTP | ASC2 | HOX1.1 | HOXA7 | KIAA0181 | NRC | PRIP | RAP250 | TRBPnuclear receptor coactivator 6Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID14638867 
NDNHsT16328 | PWCRnecdin homolog (mouse)-HPRD,BioGRID9422723 |14593116 
NDNL2HCA4 | MAGEG1 | MAGEL3 | NSE3 | NSMCE3necdin-like 2Affinity Capture-Western
Reconstituted Complex
BioGRID14593116 
NFKB1DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105nuclear factor of kappa light polypeptide gene enhancer in B-cells 1Reconstituted ComplexBioGRID9368006 
NPDC1CAB | CAB- | CAB-1 | CAB1 | DKFZp586J0523neural proliferation, differentiation and control, 1-HPRD,BioGRID11042687 
PHBPHB1prohibitinAffinity Capture-Western
Co-localization
Reconstituted Complex
BioGRID10523633 |12065415 
|14500729 |14637159 
-HPRD10523633 |14637159 
PKIBFLJ23817 | PRKACN2protein kinase (cAMP-dependent, catalytic) inhibitor betaTwo-hybridBioGRID12748276 
PPP1R13BASPP1 | KIAA0771 | p53BP2-like | p85protein phosphatase 1, regulatory (inhibitor) subunit 13BE2F1 interacts with the PPP1R13B (ASPP1) promoter.BIND15706352 
E2F1 (E2F-1) interacts with the PPP1R13B (ASPP1) promoter.BIND15731768 
PRR11FLJ11029proline rich 11E2F1 interacts with the FLJ11029 chromatin.BIND11799066 
PURAPUR-ALPHA | PUR1 | PURALPHApurine-rich element binding protein A-HPRD,BioGRID10597240 
RAD51BRCC5 | HRAD51 | HsRad51 | HsT16930 | RAD51A | RECARAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)E2F1 interacts with the RAD51 chromatin.BIND11799066 
RAD54LHR54 | RAD54A | hHR54 | hRAD54RAD54-like (S. cerevisiae)E2F1 interacts with the RAD54 promoter.BIND11799067 
RB1OSRC | RB | p105-Rb | pRb | pp110retinoblastoma 1pRB interacts with E2F-1.BIND15949438 
pRB interacts with E2F1.BIND8816797 |8816798 
Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID7739537 |8230483 
|8896460 |9422723 
|10869426 |11470869 
|12397079 
pRb interacts with E2F1.BIND15619620 
E2F1 (RBP3) interacts with pRB.BIND1638634 
-HPRD1388726 |11583618 
Rb interacts with E2F-1.BIND8346196 
Rb interacts with E2FBIND9632788 
RBBP4NURF55 | RBAP48retinoblastoma binding protein 4Affinity Capture-WesternBioGRID10734134 
RBL1CP107 | MGC40006 | PRB1 | p107retinoblastoma-like 1 (p107)Affinity Capture-Western
Reconstituted Complex
BioGRID8230483 
E2F1 interacts with the p107 promoter region.BIND10766737 
RBL2FLJ26459 | P130 | Rb2retinoblastoma-like 2 (p130)E2F-1 interacts with p130.BIND7892279 
p130 interacts with the E2F1 promoter region.BIND10766737 
RECQLRECQL1 | RecQ1RecQ protein-like (DNA helicase Q1-like)E2F1 interacts with the RECQL chromatin.BIND11799066 
RING1RING1A | RNF1ring finger protein 1Affinity Capture-WesternBioGRID11583618 
RNF144AKIAA0161 | RNF144 | UBCE7IP4ring finger protein 144ATwo-hybridBioGRID12411495 
SERTAD2MGC126688 | MGC126690 | Sei-2 | TRIP-Br2SERTA domain containing 2-HPRD11331592 
SKP2FBL1 | FBXL1 | FLB1 | MGC1366S-phase kinase-associated protein 2 (p45)-HPRD,BioGRID10559858 
SP1-Sp1 transcription factor-HPRD,BioGRID10547281 
SP2-Sp2 transcription factor-HPRD,BioGRID10547281 
SP3DKFZp686O1631 | SPR-2Sp3 transcription factor-HPRD,BioGRID10547281 
SP4HF1B | MGC130008 | MGC130009 | SPR-1Sp4 transcription factor-HPRD,BioGRID10547281 
SPIBSPI-BSpi-B transcription factor (Spi-1/PU.1 related)Two-hybridBioGRID12748276 
TEAD3DTEF-1 | ETFR-1 | TEAD5 | TEF-5 | TEF5TEA domain family member 3Two-hybridBioGRID12748276 
TFDP1DP1 | DRTF1 | Dp-1transcription factor Dp-1Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID7739537 |7892279 
|8405995 |9780002 
E2F1 interacts with DP1.BIND8816798 
TFDP2DP2 | Dp-2transcription factor Dp-2 (E2F dimerization partner 2)-HPRD8755520 |9368098 
Reconstituted ComplexBioGRID7739537 
TOPBP1TOP2BP1topoisomerase (DNA) II binding protein 1-HPRD,BioGRID12697828 
TP53BP153BP1 | FLJ41424 | MGC138366 | p202tumor protein p53 binding protein 1Affinity Capture-Western
Reconstituted Complex
BioGRID8896460 
TP53BP253BP2 | ASPP2 | BBP | PPP1R13A | p53BP2tumor protein p53 binding protein, 2E2F1 interacts with the TP53BP2 (ASPP2) promoter.BIND15706352 
E2F1 (E2F-1) interacts with the TP53BP2 (ASPP2) promoter.BIND15731768 
TP53INP1DKFZp434M1317 | FLJ22139 | SIP | TP53DINP1 | TP53INP1A | TP53INP1B | Teap | p53DINP1tumor protein p53 inducible nuclear protein 1E2F1 interacts with the TP53INP1 promoter.BIND15706352 
TRRAPFLJ10671 | PAF350/400 | PAF400 | STAF40 | TR-AP | Tra1transformation/transcription domain-associated protein-HPRD,BioGRID9708738 
TTKESK | FLJ38280 | MPS1 | MPS1L1 | PYTTTK protein kinaseE2F1 interacts with the TTK chromatin.BIND11799066 
TYMSHsT422 | MGC88736 | TMS | TS | TSasethymidylate synthetaseE2F1 interacts with the TYMS chromatin.BIND11799066 
UXTART-27ubiquitously-expressed transcriptE2F1 interacts with the UXT chromatin.BIND11799066 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-17-5p/20/93.mr/106/519.d980986m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-205285291m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-3205445501Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-33010171023m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.