Gene Page: NUDT17

Summary
GeneID  200035
Symbol  NUDT17
Synonyms  FLJ34433
Description  nudix (nucleoside diphosphate linked moiety X)-type motif 17
See related  HGNC:26618|Ensembl:ENSG00000186364|HPRD:18573|
Locus tag  -
Gene type  protein-coding
Map location  1q21.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000287magnesium ion bindingIEA-
GO:0016787hydrolase activityIEA-
GO:0030145manganese ion bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005739mitochondrionIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-409-3p44511A,m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.