Gene Page: ANKRD23

Summary
GeneID  200539
Symbol  ANKRD23
Synonyms  DARP|FLJ32449|MARP3|MGC129593
Description  ankyrin repeat domain 23
See related  HGNC:24470|MIM:610736|Ensembl:ENSG00000163126|HPRD:12462|
Locus tag  -
Gene type  protein-coding
Map location  2q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006631fatty acid metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0031674I bandIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
MYPNMYOPmyopalladin-HPRD,BioGRID14583192 
TTNCMD1G | CMH9 | CMPD4 | CONNECTIN | DKFZp451N061 | EOMFC | FLJ26020 | FLJ26409 | FLJ32040 | FLJ34413 | FLJ39564 | FLJ43066 | HMERF | LGMD2J | TMDtitin-HPRD,BioGRID14583192 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/20640461Ahsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.