Gene Page: EWSR1

Summary
GeneID  2130
Symbol  EWSR1
Synonyms  EWS
Description  Ewing sarcoma breakpoint region 1
See related  HGNC:3508|MIM:133450|Ensembl:ENSG00000182944|HPRD:00592|
Locus tag  AC002059.7
Gene type  protein-coding
Map location  22q12.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.017 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
CUL90.870.88
ZCCHC20.860.89
IPPK0.860.86
EIF4G30.860.86
VPS530.860.86
STAT20.850.86
PDCD6IP0.850.85
UBE3B0.850.85
ZNF3310.850.84
MAP3K40.850.85
Top 10 negatively co-expressed genes
AF347015.21-0.72-0.64
AF347015.31-0.65-0.58
C1orf54-0.65-0.67
GNG11-0.65-0.62
HIGD1B-0.64-0.58
MT-CO2-0.63-0.56
VAMP5-0.63-0.61
IL32-0.63-0.57
PLA2G5-0.61-0.57
METRN-0.61-0.58
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003676nucleic acid bindingIEA-
GO:0003700transcription factor activityIEA-
GO:0003723RNA bindingTAS8084618 
GO:0005516calmodulin bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
GO:0009986cell surfaceIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTL6AACTL6 | Arp4 | BAF53A | INO80K | MGC5382actin-like 6ATwo-hybridBioGRID16189514 
AGTANHU | FLJ92595 | FLJ97926 | SERPINA8angiotensinogen (serpin peptidase inhibitor, clade A, member 8)Two-hybridBioGRID16189514 
ARHGDIAGDIA1 | MGC117248 | RHOGDI | RHOGDI-1Rho GDP dissociation inhibitor (GDI) alphaAffinity Capture-MSBioGRID17353931 
BADBBC2 | BCL2L8BCL2-associated agonist of cell deathTwo-hybridBioGRID16189514 
BARD1-BRCA1 associated RING domain 1-HPRD,BioGRID12183411 
BNIP3LBNIP3a | NIXBCL2/adenovirus E1B 19kDa interacting protein 3-likeTwo-hybridBioGRID16189514 
BTKAGMX1 | AT | ATK | BPK | IMD1 | MGC126261 | MGC126262 | PSCTK1 | XLABruton agammaglobulinemia tyrosine kinase-HPRD,BioGRID9201297 
C10orf12DKFZp564P1916 | FLJ13022chromosome 10 open reading frame 12Two-hybridBioGRID16189514 
C11orf16-chromosome 11 open reading frame 16Two-hybridBioGRID16189514 
C18orf10DKFZp586M1523 | HMFN0601 | HsT3006 | L17 | PGs2chromosome 18 open reading frame 10Two-hybridBioGRID16189514 
C19orf50FLJ25480 | MGC2749 | MST096 | MSTP096chromosome 19 open reading frame 50Two-hybridBioGRID16189514 
C19orf57MGC11271 | MGC149720chromosome 19 open reading frame 57Two-hybridBioGRID16189514 
C1orf71FLJ32001 | MGC18089chromosome 1 open reading frame 71Two-hybridBioGRID16189514 
CALM1CALML2 | CAMI | DD132 | PHKDcalmodulin 1 (phosphorylase kinase, delta)Reconstituted ComplexBioGRID9341188 
CCDC7BioT2-A | BioT2-B | BioT2-C | DKFZp686N0559 | FLJ32762 | RP11-479G22.1coiled-coil domain containing 7Two-hybridBioGRID16189514 
CCDC91DKFZp779L1558 | FLJ11088 | HSD8 | p56coiled-coil domain containing 91Two-hybridBioGRID16189514 
CD177HNA2A | NB1 | PRV1CD177 moleculeTwo-hybridBioGRID16189514 
CD2BP2FWP010 | LIN1 | Snu40 | U5-52KCD2 (cytoplasmic tail) binding protein 2Affinity Capture-MSBioGRID17353931 
CEACAM5CD66e | CEA | DKFZp781M2392carcinoembryonic antigen-related cell adhesion molecule 5Two-hybridBioGRID16189514 
CETPHDLCQ10cholesteryl ester transfer protein, plasmaTwo-hybridBioGRID16189514 
CFDP1BCNT | BUCENTAUR | CP27 | SWC5 | Yeti | p97craniofacial development protein 1Two-hybridBioGRID16189514 
CPSF6CFIM | CFIM68 | HPBRII-4 | HPBRII-7cleavage and polyadenylation specific factor 6, 68kDaTwo-hybridBioGRID16189514 
CREBBPCBP | KAT3A | RSTSCREB binding protein-HPRD,BioGRID12459554 
CUEDC2C10orf66 | MGC2491 | bA18I14.5CUE domain containing 2Two-hybridBioGRID16189514 
CXADRCAR | HCARcoxsackie virus and adenovirus receptorTwo-hybridBioGRID16189514 
DFFADFF-45 | DFF1 | ICADDNA fragmentation factor, 45kDa, alpha polypeptideTwo-hybridBioGRID16189514 
DMRTB1-DMRT-like family B with proline-rich C-terminal, 1Two-hybridBioGRID16189514 
DNAJB3HCG3 | MGC26879DnaJ (Hsp40) homolog, subfamily B, member 3Two-hybridBioGRID16189514 
DYNLL2DNCL1B | Dlc2 | MGC17810dynein, light chain, LC8-type 2Two-hybridBioGRID16189514 
ELAVL3DKFZp547J036 | HUC | HUCL | MGC20653 | PLE21ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)Two-hybridBioGRID16189514 
ELAVL4HUD | PNEMELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)Two-hybridBioGRID16189514 
ELK1-ELK1, member of ETS oncogene familyReconstituted ComplexBioGRID9010223 
FAM131CC1orf117 | FLJ36766 | RP11-5P18.9family with sequence similarity 131, member CTwo-hybridBioGRID16189514 
FASNFAS | MGC14367 | MGC15706 | OA-519fatty acid synthaseTwo-hybridBioGRID16189514 
FLJ12529FLJ39024 | MGC9315pre-mRNA cleavage factor I, 59 kDa subunitTwo-hybridBioGRID16189514 
GNPDA1GNPDA | GNPI | GPI | HLN | KIAA0060glucosamine-6-phosphate deaminase 1Two-hybridBioGRID16189514 
GPBP1L1RP11-767N6.1 | SP192GC-rich promoter binding protein 1-like 1Two-hybridBioGRID16189514 
GSK3B-glycogen synthase kinase 3 betaAffinity Capture-MSBioGRID17353931 
HERPUD1HERP | KIAA0025 | Mif1 | SUPhomocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1Two-hybridBioGRID16189514 
HMGA1HMG-R | HMGA1A | HMGIY | MGC12816 | MGC4242 | MGC4854high mobility group AT-hook 1Two-hybridBioGRID16189514 
ILKDKFZp686F1765 | P59integrin-linked kinaseAffinity Capture-MSBioGRID17353931 
KCNMB1K(VCA)beta | SLO-BETA | hslo-betapotassium large conductance calcium-activated channel, subfamily M, beta member 1Two-hybridBioGRID16189514 
KELCD238 | ECE3Kell blood group, metallo-endopeptidaseTwo-hybridBioGRID16189514 
KHDRBS2FLJ38664 | MGC26664 | SLM-1 | SLM1 | bA535F17.1KH domain containing, RNA binding, signal transduction associated 2Two-hybridBioGRID16189514 
KRR1HRB2 | RIP-1KRR1, small subunit (SSU) processome component, homolog (yeast)Two-hybridBioGRID16189514 
LILRA3CD85E | HM31 | HM43 | ILT6 | LIR-4 | LIR4 | e3leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3Two-hybridBioGRID16189514 
MAGEA11MAGE-11 | MAGE11 | MAGEA-11 | MGC10511melanoma antigen family A, 11Two-hybridBioGRID16189514 
MAPK1IP1LC14orf32 | MGC23138 | MISS | c14_5346mitogen-activated protein kinase 1 interacting protein 1-likeTwo-hybridBioGRID16189514 
MATKCHK | CTK | DKFZp434N1212 | HHYLTK | HYL | HYLTK | Lsk | MGC1708 | MGC2101megakaryocyte-associated tyrosine kinaseTwo-hybridBioGRID16189514 
MDFII-MF | I-mfaMyoD family inhibitorTwo-hybridBioGRID16189514 
MNS1FLJ11222 | FLJ26051meiosis-specific nuclear structural 1Two-hybridBioGRID16189514 
MRPS18BC6orf14 | DKFZp564H0223 | HSPC183 | HumanS18a | MRP-S18-2 | MRPS18-2 | PTD017 | S18amtmitochondrial ribosomal protein S18BTwo-hybridBioGRID16189514 
MSCABF-1 | ABF1 | MYOR | bHLHa22musculin (activated B-cell factor-1)Two-hybridBioGRID16189514 
MTCP1C6.1Bmature T-cell proliferation 1Two-hybridBioGRID16189514 
MTMR9C8orf9 | DKFZp434K171 | LIP-STYX | MGC126672 | MTMR8myotubularin related protein 9Two-hybridBioGRID16189514 
MVKFLJ96772 | LRBP | MK | MVLKmevalonate kinaseTwo-hybridBioGRID16189514 
MYL6ESMLC | LC17-GI | LC17-NM | LC17A | LC17B | MLC1SM | MLC3NM | MLC3SMmyosin, light chain 6, alkali, smooth muscle and non-muscleTwo-hybridBioGRID16189514 
MYO1F-myosin IFTwo-hybridBioGRID16189514 
MYOZ2C4orf5 | CS-1myozenin 2Two-hybridBioGRID16189514 
NBPF3AE2 | DKFZp434D177neuroblastoma breakpoint family, member 3Two-hybridBioGRID16189514 
NDUFB1CI-SGDH | MNLLNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDaTwo-hybridBioGRID16189514 
NDUFV1CI-51kD | UQOR1NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDaTwo-hybridBioGRID16189514 
NLE1FLJ10458 | Nlenotchless homolog 1 (Drosophila)Two-hybridBioGRID16189514 
NPPBBNPnatriuretic peptide precursor BTwo-hybridBioGRID16189514 
NSUN4MGC22960 | RP4-603I14.2NOL1/NOP2/Sun domain family, member 4Two-hybridBioGRID16189514 
NTNG2KIAA0625 | KIAA1857 | LHLL9381 | Lmnt2 | MGC21884 | NTNG1 | bA479K20.1netrin G2Two-hybridBioGRID16189514 
PDHXDLDBP | E3BP | OPDX | PDX1 | proXpyruvate dehydrogenase complex, component XTwo-hybridBioGRID16189514 
PGLS6PGL6-phosphogluconolactonaseTwo-hybridBioGRID16189514 
PLSCR1MMTRA1Bphospholipid scramblase 1Two-hybridBioGRID16189514 
POLR2GMGC138367 | MGC138369 | RPB7 | hRPB19 | hsRPB7polymerase (RNA) II (DNA directed) polypeptide G-HPRD9704926 
POU4F1BRN3A | FLJ13449 | Oct-T1 | RDC-1POU class 4 homeobox 1-HPRD,BioGRID12432261 
PRTFDC1FLJ11888 | HHGPphosphoribosyl transferase domain containing 1Two-hybridBioGRID16189514 
PRUNE2A214N16.3 | BMCC1 | BNIPXL | C9orf65 | DKFZp762K117 | FLJ50060 | FLJ54876 | FLJ59118 | KIAA0367 | RP11-58J3.2 | bA214N16.3prune homolog 2 (Drosophila)Two-hybridBioGRID16189514 
PTK2BCADTK | CAKB | FADK2 | FAK2 | FRNK | PKB | PTK | PYK2 | RAFTKPTK2B protein tyrosine kinase 2 beta-HPRD,BioGRID10322114 
PUF60FIR | FLJ31379 | RoBPI | SIAHBP1poly-U binding splicing factor 60KDaAffinity Capture-MSBioGRID17353931 
RAB37FLJ30284 | FLJ32507RAB37, member RAS oncogene familyTwo-hybridBioGRID16189514 
RAD23AHHR23A | MGC111083RAD23 homolog A (S. cerevisiae)Two-hybridBioGRID16189514 
RALYLHNRPCL3RALY RNA binding protein-likeTwo-hybridBioGRID16189514 
RASL11BMGC2827 | MGC4499RAS-like, family 11, member BTwo-hybridBioGRID16189514 
RBPMSHERMESRNA binding protein with multiple splicingTwo-hybridBioGRID16189514 
RHOXF2PEPP-2 | PEPP2 | THG1Rhox homeobox family, member 2Two-hybridBioGRID16189514 
RMND5BDKFZp434K0926 | FLJ22318required for meiotic nuclear division 5 homolog B (S. cerevisiae)Two-hybridBioGRID16189514 
RNF183FLJ31197 | MGC4734ring finger protein 183Two-hybridBioGRID16189514 
RP4-691N24.1FLJ11792 | KIAA0980 | NLP | dJ691N24.1ninein-likeTwo-hybridBioGRID16189514 
RPL31MGC88191ribosomal protein L31Two-hybridBioGRID16189514 
RPS15AFLJ27457 | MGC111208 | S15aribosomal protein S15aTwo-hybridBioGRID16189514 
SALL2FLJ10414 | FLJ55746 | HSAL2 | KIAA0360 | ZNF795 | p150(Sal2)sal-like 2 (Drosophila)Two-hybridBioGRID16189514 
SELIKIAA1724selenoprotein ITwo-hybridBioGRID16189514 
SERP2C13orf21 | MGC35505 | RP11-269C23.1 | bA269C23.1stress-associated endoplasmic reticulum protein family member 2Two-hybridBioGRID16189514 
SF1D11S636 | ZFM1 | ZNF162splicing factor 1-HPRD,BioGRID9660765 
SLC1A1EAAC1 | EAAT3solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1Two-hybridBioGRID16189514 
SLC22A24MGC34821solute carrier family 22, member 24Two-hybridBioGRID16189514 
SMAD4DPC4 | JIP | MADH4SMAD family member 4Two-hybridBioGRID16189514 
SMNDC1SMNR | SPF30survival motor neuron domain containing 1Affinity Capture-MSBioGRID17353931 
SNRPCFLJ20302small nuclear ribonucleoprotein polypeptide C-HPRD,BioGRID10827180 
SSBP2DKFZp686F03273 | HSPC116single-stranded DNA binding protein 2Two-hybridBioGRID16189514 
SUV39H2FLJ23414 | KMT1Bsuppressor of variegation 3-9 homolog 2 (Drosophila)Two-hybridBioGRID16189514 
TAF1BA2R | CCG1 | CCGS | DYT3 | KAT4 | N-TAF1 | NSCL2 | OF | P250 | TAF2A | TAFII250TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa-HPRD9488465 
TMSB4YMGC26307 | TB4Ythymosin beta 4, Y-linkedTwo-hybridBioGRID16189514 
TRIM37KIAA0898 | MUL | POB1 | TEF3tripartite motif-containing 37Two-hybridBioGRID16189514 
TRPV5CAT2 | ECAC1 | OTRPC3transient receptor potential cation channel, subfamily V, member 5Two-hybridBioGRID16189514 
TSPAN3TM4-A | TM4SF8 | TSPAN-3tetraspanin 3Two-hybridBioGRID16189514 
TULP2TUBL2tubby like protein 2Two-hybridBioGRID16189514 
VPS72CFL1 | Swc2 | TCFL1 | YL-1 | YL1vacuolar protein sorting 72 homolog (S. cerevisiae)Two-hybridBioGRID16189514 
WDR37FLJ40354 | KIAA0982 | RP11-529L18.2WD repeat domain 37Two-hybridBioGRID16189514 
WWP1AIP5 | DKFZp434D2111 | Tiul1 | hSDRP1WW domain containing E3 ubiquitin protein ligase 1Two-hybridBioGRID16189514 
WWP2AIP2 | WWp2-likeWW domain containing E3 ubiquitin protein ligase 2Two-hybridBioGRID16189514 
YY1AP1FLJ10875 | FLJ13914 | HCCA1 | HCCA2 | YAP | YY1APYY1 associated protein 1Two-hybridBioGRID16189514 
ZDHHC3DKFZp313D2314 | FLJ20209 | FLJ45940 | GODZ | ZNF373zinc finger, DHHC-type containing 3Two-hybridBioGRID16189514 
ZNF165LD65 | ZSCAN7zinc finger protein 165Affinity Capture-Western
Two-hybrid
BioGRID16189514 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
PID_BARD1_PATHWAY 2919All SZGR genes in this pathway
OSMAN_BLADDER_CANCER_UP 404246All SZGR genes in this pathway
GINESTIER_BREAST_CANCER_20Q13_AMPLIFICATION_DN 180101All SZGR genes in this pathway
GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN 17811082All SZGR genes in this pathway
MYLLYKANGAS_AMPLIFICATION_HOT_SPOT_22 139All SZGR genes in this pathway
DACOSTA_UV_RESPONSE_VIA_ERCC3_UP 309199All SZGR genes in this pathway
PUJANA_BRCA1_PCC_NETWORK 16521023All SZGR genes in this pathway
PUJANA_ATM_PCC_NETWORK 1442892All SZGR genes in this pathway
PUJANA_CHEK2_PCC_NETWORK 779480All SZGR genes in this pathway
LOPEZ_MBD_TARGETS 957597All SZGR genes in this pathway
MORI_MATURE_B_LYMPHOCYTE_DN 7543All SZGR genes in this pathway
SMITH_TERT_TARGETS_UP 14591All SZGR genes in this pathway
TARTE_PLASMA_CELL_VS_PLASMABLAST_DN 309206All SZGR genes in this pathway
PENG_GLUTAMINE_DEPRIVATION_DN 337230All SZGR genes in this pathway
ZHAN_MULTIPLE_MYELOMA_SUBGROUPS 3020All SZGR genes in this pathway
ZHAN_MULTIPLE_MYELOMA_UP 6446All SZGR genes in this pathway
BLALOCK_ALZHEIMERS_DISEASE_INCIPIENT_UP 390242All SZGR genes in this pathway
JIANG_VHL_TARGETS 13891All SZGR genes in this pathway
BLALOCK_ALZHEIMERS_DISEASE_UP 16911088All SZGR genes in this pathway
KRIGE_RESPONSE_TO_TOSEDOSTAT_6HR_DN 911527All SZGR genes in this pathway
KRIGE_RESPONSE_TO_TOSEDOSTAT_24HR_DN 1011592All SZGR genes in this pathway
MARSON_BOUND_BY_FOXP3_UNSTIMULATED 1229713All SZGR genes in this pathway
ZHANG_BREAST_CANCER_PROGENITORS_UP 425253All SZGR genes in this pathway
BLUM_RESPONSE_TO_SALIRASIB_DN 342220All SZGR genes in this pathway
MUELLER_PLURINET 299189All SZGR genes in this pathway
YAUCH_HEDGEHOG_SIGNALING_PARACRINE_UP 14985All SZGR genes in this pathway
GRESHOCK_CANCER_COPY_NUMBER_UP 323240All SZGR genes in this pathway
ROME_INSULIN_TARGETS_IN_MUSCLE_UP 442263All SZGR genes in this pathway
DORN_ADENOVIRUS_INFECTION_12HR_DN 3325All SZGR genes in this pathway
DORN_ADENOVIRUS_INFECTION_24HR_DN 4332All SZGR genes in this pathway
DORN_ADENOVIRUS_INFECTION_32HR_DN 3928All SZGR genes in this pathway
DORN_ADENOVIRUS_INFECTION_48HR_DN 4029All SZGR genes in this pathway
JIANG_HYPOXIA_VIA_VHL 3424All SZGR genes in this pathway
PILON_KLF1_TARGETS_DN 19721213All SZGR genes in this pathway
JOHNSTONE_PARVB_TARGETS_3_DN 918550All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-299-5p46521Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.