Gene Page: SLC39A12

Summary
GeneID  221074
Symbol  SLC39A12
Synonyms  FLJ30499|MGC43205|MGC51099|bA570F3.1
Description  solute carrier family 39 (zinc transporter), member 12
See related  HGNC:20860|MIM:608734|Ensembl:ENSG00000148482|HPRD:15384|
Locus tag  -
Gene type  protein-coding
Map location  10p12.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008270zinc ion bindingIEA-
GO:0046873metal ion transmembrane transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0030001metal ion transportIEA-
GO:0006829zinc ion transportIEA-
GO:0006811ion transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-543311317m8hsa-miR-543AAACAUUCGCGGUGCACUUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.