Gene Page: XPO6

Summary
GeneID  23214
Symbol  XPO6
Synonyms  EXP6|FLJ22519|KIAA0370|RANBP20
Description  exportin 6
See related  HGNC:19733|MIM:608411|Ensembl:ENSG00000169180|HPRD:10525|
Locus tag  -
Gene type  protein-coding
Map location  16p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI14592989 
GO:0008565protein transporter activityIDA14592989 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000059protein import into nucleus, dockingIEA-
GO:0006611protein export from nucleusIDA14592989 
GO:0006886intracellular protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIC14592989 
GO:0005643nuclear poreIEA-
GO:0005737cytoplasmIC14592989 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTA1ACTA | ASMA | CFTD | CFTD1 | CFTDM | MPFD | NEM1 | NEM2 | NEM3actin, alpha 1, skeletal muscleAffinity Capture-MSBioGRID14592989 
ACTBPS1TP5BP1actin, beta-HPRD14592989 
BRF2BRFU | FLJ11052 | TFIIIB50BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-likeAffinity Capture-MSBioGRID17353931 
DIAPH1DFNA1 | DIA1 | DRF1 | FLJ25265 | LFHL1 | hDIA1diaphanous homolog 1 (Drosophila)-HPRD,BioGRID14592989 
EGFRERBB | ERBB1 | HER1 | PIG61 | mENAepidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)-HPRD14592989 
ENAHENA | MENA | NDPP1enabled homolog (Drosophila)Affinity Capture-MSBioGRID14592989 
GSK3B-glycogen synthase kinase 3 betaAffinity Capture-MSBioGRID17353931 
NUP62DKFZp547L134 | FLJ20822 | FLJ43869 | IBSN | MGC841 | SNDI | p62nucleoporin 62kDaTwo-hybridBioGRID16189514 
PFN1-profilin 1-HPRD,BioGRID14592989 
RANARA24 | Gsp1 | TC4RAN, member RAS oncogene familyAffinity Capture-MSBioGRID14592989 
VASP-vasodilator-stimulated phosphoprotein-HPRD,BioGRID14592989 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2064894951Ahsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-5394814871Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.