Gene Page: POFUT1

Summary
GeneID  23509
Symbol  POFUT1
Synonyms  FUT12|KIAA0180|MGC2482|O-FUT|O-Fuc-T|O-FucT-1
Description  protein O-fucosyltransferase 1
See related  HGNC:14988|MIM:607491|Ensembl:ENSG00000101346|HPRD:06319|
Locus tag  -
Gene type  protein-coding
Map location  20q11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016757transferase activity, transferring glycosyl groupsIEA-
GO:0030145manganese ion bindingIEA-
GO:0046922peptide-O-fucosyltransferase activityTAS11698403 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0001756somitogenesisIEA-
GO:0001525angiogenesisIEA-
GO:0007219Notch signaling pathwayIEA-
GO:0006004fucose metabolic processIEA-
GO:0005975carbohydrate metabolic processIEA-
GO:0009790embryonic developmentNAS11698403 
GO:0007507heart developmentIEA-
GO:0016266O-glycan processingTAS11698403 
GO:0045449regulation of transcriptionNAS11698403 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005783endoplasmic reticulumIEA-
GO:0016020membraneIDA9023546 |11524432 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-34/449528534m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.