Gene Page: MAPK8IP2

Summary
GeneID  23542
Symbol  MAPK8IP2
Synonyms  IB2|JIP2|PRKM8IPL
Description  mitogen-activated protein kinase 8 interacting protein 2
See related  HGNC:6883|MIM:607755|Ensembl:ENSG00000008735|HPRD:09674|
Locus tag  -
Gene type  protein-coding
Map location  22q13.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0001540beta-amyloid bindingNAS12023290 
GO:0005078MAP-kinase scaffold activityNAS10490659 
GO:0005198structural molecule activityTAS10490659 
GO:0019894kinesin bindingISS-
GO:0019901protein kinase bindingIPI10490659 
GO:0030295protein kinase activator activityIDA12244047 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007172signal complex assemblyTAS10490659 
GO:0045768positive regulation of anti-apoptosisNAS10756100 
GO:0046328regulation of JNK cascadeIDA10490659 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0043025cell somaIEAaxon, dendrite (GO term level: 4)-
GO:0005737cytoplasmIDA10490659 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DUSP16KIAA1700 | MGC129701 | MGC129702 | MKP-7 | MKP7dual specificity phosphatase 16-HPRD,BioGRID12524447 
FGF12FGF12B | FHF1fibroblast growth factor 12-HPRD,BioGRID11378392 
FGF13FGF2 | FHF2fibroblast growth factor 13-HPRD,BioGRID12244047 
IL1BIL-1 | IL1-BETA | IL1F2interleukin 1, betaPhenotypic SuppressionBioGRID10756100 
LRP1A2MR | APOER | APR | CD91 | FLJ16451 | IGFBP3R | LRP | MGC88725 | TGFBR5low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor)Reconstituted Complex
Two-hybrid		BioGRID10827173 
LRP2DBS | gp330low density lipoprotein-related protein 2Reconstituted Complex
Two-hybrid		BioGRID10827173 |12508107 
LRP8APOER2 | HSZ75190 | MCI1low density lipoprotein receptor-related protein 8, apolipoprotein e receptorTwo-hybridBioGRID10827173 
MAP2K3MAPKK3 | MEK3 | MKK3 | PRKMK3mitogen-activated protein kinase kinase 3Affinity Capture-WesternBioGRID12024021 
MAP2K7Jnkk2 | MAPKK7 | MKK7 | PRKMK7mitogen-activated protein kinase kinase 7-HPRD,BioGRID10756100 
MAP3K10MLK2 | MSTmitogen-activated protein kinase kinase kinase 10Affinity Capture-Western
Reconstituted Complex		BioGRID10490659 
MAP3K11MGC17114 | MLK-3 | MLK3 | PTK1 | SPRKmitogen-activated protein kinase kinase kinase 11-HPRD,BioGRID10490659 
MAP3K12DLK | MUK | ZPK | ZPKP1mitogen-activated protein kinase kinase kinase 12Affinity Capture-Western
Reconstituted Complex		BioGRID10490659 
MAPK10FLJ12099 | FLJ33785 | JNK3 | JNK3A | MGC50974 | PRKM10 | p493F12 | p54bSAPKmitogen-activated protein kinase 10Reconstituted ComplexBioGRID10756100 
MAPK13MGC99536 | PRKM13 | SAPK4 | p38deltamitogen-activated protein kinase 13-HPRD,BioGRID12244047 
MAPK8JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1mitogen-activated protein kinase 8-HPRD10756100 
MAPK8IP1IB1 | JIP-1 | JIP1 | PRKM8IPmitogen-activated protein kinase 8 interacting protein 1Affinity Capture-Western
Reconstituted Complex		BioGRID10490659 
MAPK8IP2IB2 | JIP2 | PRKM8IPLmitogen-activated protein kinase 8 interacting protein 2Affinity Capture-WesternBioGRID10490659 
MAPK8IP3DKFZp762N1113 | FLJ00027 | JIP3 | JSAP1 | KIAA1066 | SYD2mitogen-activated protein kinase 8 interacting protein 3-HPRD,BioGRID10629060 
MAPK9JNK-55 | JNK2 | JNK2A | JNK2ALPHA | JNK2B | JNK2BETA | PRKM9 | SAPK | p54a | p54aSAPKmitogen-activated protein kinase 9Affinity Capture-Western
Reconstituted Complex		BioGRID10490659 
PRSS23MGC5107 | SIG13 | SPUVE | ZSIG13protease, serine, 23Two-hybridBioGRID16169070 
TIAM1FLJ36302T-cell lymphoma invasion and metastasis 1Affinity Capture-WesternBioGRID12024021 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_MAPK_SIGNALING_PATHWAY 267205All SZGR genes in this pathway
ST_DIFFERENTIATION_PATHWAY_IN_PC12_CELLS 4535All SZGR genes in this pathway
SIG_CD40PATHWAYMAP 3428All SZGR genes in this pathway
ST_GRANULE_CELL_SURVIVAL_PATHWAY 2723All SZGR genes in this pathway
ST_INTEGRIN_SIGNALING_PATHWAY 8262All SZGR genes in this pathway
ST_FAS_SIGNALING_PATHWAY 6554All SZGR genes in this pathway
HAMAI_APOPTOSIS_VIA_TRAIL_DN 186107All SZGR genes in this pathway
AIYAR_COBRA1_TARGETS_UP 3925All SZGR genes in this pathway
PATIL_LIVER_CANCER 747453All SZGR genes in this pathway
GRUETZMANN_PANCREATIC_CANCER_DN 203134All SZGR genes in this pathway
BENPORATH_SUZ12_TARGETS 1038678All SZGR genes in this pathway
BENPORATH_ES_WITH_H3K27ME3 1118744All SZGR genes in this pathway
MOREAUX_MULTIPLE_MYELOMA_BY_TACI_UP 412249All SZGR genes in this pathway
MOREAUX_B_LYMPHOCYTE_MATURATION_BY_TACI_UP 9258All SZGR genes in this pathway
BROWNE_HCMV_INFECTION_14HR_UP 156101All SZGR genes in this pathway
YOSHIMURA_MAPK8_TARGETS_UP 1305895All SZGR genes in this pathway
HAN_SATB1_TARGETS_DN 442275All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3K4ME3_AND_H3K27ME3 142103All SZGR genes in this pathway
MIKKELSEN_NPC_HCP_WITH_H3K4ME3_AND_H3K27ME3 210148All SZGR genes in this pathway
MIKKELSEN_MEF_HCP_WITH_H3K27ME3 590403All SZGR genes in this pathway
KIM_ALL_DISORDERS_OLIGODENDROCYTE_NUMBER_CORR_UP 756494All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-188461467m8hsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.