Gene Page: RASD2

Summary
GeneID  23551
Symbol  RASD2
Synonyms  MGC:4834|Rhes|TEM2
Description  RASD family, member 2
See related  HGNC:18229|Ensembl:ENSG00000100302|HPRD:15210|
Locus tag  -
Gene type  protein-coding
Map location  22q13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0071 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityNAS11976265 
GO:0005525GTP bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007626locomotory behaviorIEA-
GO:0007264small GTPase mediated signal transductionIC11976265 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
GO:0005622intracellularIEA-
GO:0005737cytoplasmIDA18029348 
GO:0005886plasma membraneIDA18029348 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PIK3CAMGC142161 | MGC142163 | PI3K | p110-alphaphosphoinositide-3-kinase, catalytic, alpha polypeptide-HPRD,BioGRID14724584 
RAF1CRAF | NS5 | Raf-1 | c-Rafv-raf-1 murine leukemia viral oncogene homolog 1Reconstituted ComplexBioGRID14724584 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1017427491A,m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-1447437491Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-495195619631A,m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-913561362m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.