Gene Page: TSSK2

Summary
GeneID  23617
Symbol  TSSK2
Synonyms  DGS-G|FLJ38613|SPOGA2|STK22B
Description  testis-specific serine kinase 2
See related  HGNC:11401|MIM:610710|Ensembl:ENSG00000206203|HPRD:10255|
Locus tag  -
Gene type  protein-coding
Map location  22q11.21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0000287magnesium ion bindingISS-
GO:0005515protein bindingIPI15044604 
GO:0005524ATP bindingISS-
GO:0004674protein serine/threonine kinase activityISS-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationISS-
GO:0007283spermatogenesisIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
TFGFLJ36137 | TF6 | TRKT3TRK-fused gene-HPRD11591653 
TSKSTSKS1testis-specific kinase substrate-HPRD,BioGRID15044604 
TSSK2DGS-G | FLJ38613 | SPOGA2 | STK22Btestis-specific serine kinase 2Biochemical ActivityBioGRID15044604 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-140129135m8hsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-299-5p1281341Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-5001051121A,m8hsa-miR-500AUGCACCUGGGCAAGGAUUCUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.