|
GeneID |
238
|
Symbol |
ALK
|
Synonyms |
CD246|Ki-1|TFG/ALK
|
Description |
anaplastic lymphoma receptor tyrosine kinase |
See related |
HGNC:427|MIM:105590|Ensembl:ENSG00000171094|HPRD:00104| |
Locus tag |
- |
Gene type |
protein-coding |
Map location |
2p23 |
|
|
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
TBXAS1 | 0.87 | 0.83 | | |
C3AR1 | 0.86 | 0.80 | | |
P2RY12 | 0.81 | 0.79 | | |
C1QC | 0.81 | 0.83 | | |
LAPTM5 | 0.80 | 0.84 | | |
ADORA3 | 0.80 | 0.82 | | |
RNASE6 | 0.78 | 0.82 | | |
CD53 | 0.77 | 0.80 | | |
C3 | 0.77 | 0.82 | | |
GPR34 | 0.77 | 0.80 | | |
Top 10 negatively co-expressed genes | SH3BP2 | -0.34 | -0.42 | | |
ZNF814 | -0.34 | -0.40 | | |
ZNF418 | -0.34 | -0.31 | | |
KIAA1949 | -0.33 | -0.30 | | |
VAV2 | -0.33 | -0.27 | | |
GJC1 | -0.33 | -0.32 | | |
AC004017.1 | -0.33 | -0.25 | | |
AL033532.1 | -0.33 | -0.26 | | |
AC010522.1 | -0.33 | -0.39 | | |
UPF3A | -0.33 | -0.39 | | |
|
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0004714 | transmembrane receptor protein tyrosine kinase activity | IDA | neurite (GO term level: 8) | 9174053 |
GO:0000166 | nucleotide binding | IEA | | - |
GO:0004872 | receptor activity | IEA | | - |
GO:0004716 | receptor signaling protein tyrosine kinase activity | TAS | | 9053841 |
GO:0005515 | protein binding | IEA | | - |
GO:0005524 | ATP binding | IEA | | - |
GO:0016740 | transferase activity | IEA | | - |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0007420 | brain development | TAS | Brain (GO term level: 7) | 9053841 |
GO:0007399 | nervous system development | IMP | neurite (GO term level: 5) | 11121404 |
GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | IEA | | - |
GO:0006468 | protein amino acid phosphorylation | IEA | | - |
GO:0006487 | protein amino acid N-linked glycosylation | IMP | | 9174053 |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0016020 | membrane | IEA | | - |
GO:0005887 | integral to plasma membrane | TAS | | 9053841 |
|
|
|
|
|
|
|
miR-96 | 107 | 113 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|