Gene Page: ZDHHC20

Summary
GeneID  253832
Symbol  ZDHHC20
Synonyms  FLJ25952|MGC126005
Description  zinc finger, DHHC-type containing 20
See related  HGNC:20749|Ensembl:ENSG00000180776|HPRD:08078|
Locus tag  -
Gene type  protein-coding
Map location  13q12.11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016740transferase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0008415acyltransferase activityIEA-
GO:0046872metal ion bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.11541611A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5061541601Ahsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-2242052121A,m8hsa-miR-224CAAGUCACUAGUGGUUCCGUUUA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.