Gene Page: KCTD13

Summary
GeneID  253980
Symbol  KCTD13
Synonyms  FKSG86|PDIP1|POLDIP1
Description  potassium channel tetramerisation domain containing 13
See related  HGNC:22234|MIM:608947|Ensembl:ENSG00000174943|HPRD:12339|
Locus tag  -
Gene type  protein-coding
Map location  16p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005249voltage-gated potassium channel activityIEA-
GO:0042802identical protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006260DNA replicationISS15726626 
GO:0006813potassium ion transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0016020membraneIEA-
GO:0008076voltage-gated potassium channel complexIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARMC7FLJ22160armadillo repeat containing 7Two-hybridBioGRID16189514 
LNX1LNX | MPDZ | PDZRN2ligand of numb-protein X 1Two-hybridBioGRID16189514 
MYST2HBO1 | HBOA | KAT7MYST histone acetyltransferase 2Two-hybridBioGRID16189514 
NUDT18FLJ22494nudix (nucleoside diphosphate linked moiety X)-type motif 18Two-hybridBioGRID16189514 
PCNAMGC8367proliferating cell nuclear antigenC terminus of PDIP1 interacts with PCNA.BIND11593007 
-HPRD,BioGRID11593007 
POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDaPDIP1 interacts with DNA polymerase delta p50.BIND11593007 
-HPRD,BioGRID11593007 
VTA1C6orf55 | DRG-1 | DRG1 | FLJ27228 | HSPC228 | LIP5 | My012 | SBP1Vps20-associated 1 homolog (S. cerevisiae)Two-hybridBioGRID16189514 
ZMYND19MIZIP | RP11-48C7.4zinc finger, MYND-type containing 19Two-hybridBioGRID16189514 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/206187193m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.