Gene Page: RASGEF1C

Summary
GeneID  255426
Symbol  RASGEF1C
Synonyms  FLJ35841
Description  RasGEF domain family, member 1C
See related  HGNC:27400|Ensembl:ENSG00000146090|HPRD:15212|
Locus tag  -
Gene type  protein-coding
Map location  5q35.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.0276 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005085guanyl-nucleotide exchange factor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0051056regulation of small GTPase mediated signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-542-3p383389m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.