Gene Page: SIN3A

Summary
GeneID  25942
Symbol  SIN3A
Synonyms  DKFZp434K2235|FLJ90319|KIAA0700
Description  SIN3 homolog A, transcription regulator (yeast)
See related  HGNC:19353|MIM:607776|Ensembl:ENSG00000169375|HPRD:09690|
Locus tag  -
Gene type  protein-coding
Map location  15q24.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0475 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI11238380 |12670868 
GO:0005515protein bindingISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionIEA-
GO:0045892negative regulation of transcription, DNA-dependentISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusISS-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AOF2BHC110 | KDM1 | KIAA0601 | LSD1amine oxidase (flavin containing) domain 2Affinity Capture-WesternBioGRID11171972 
ARID4BBCAA | BRCAA1 | DKFZp313M2420 | MGC163290 | RBBP1L1 | RBP1L1 | SAP180AT rich interactive domain 4B (RBP1-like)-HPRD,BioGRID12724404 
BCL6BCL5 | BCL6A | LAZ3 | ZBTB27 | ZNF51B-cell CLL/lymphoma 6Reconstituted ComplexBioGRID9765306 
CABIN1CAIN | KIAA0330 | PPP3INcalcineurin binding protein 1-HPRD,BioGRID10933397 
COPS2ALIEN | CSN2 | SGN2 | TRIP15COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)Affinity Capture-WesternBioGRID10207062 
CTBP1BARS | MGC104684C-terminal binding protein 1in vivoBioGRID10766745 
DACH1DACH | FLJ10138dachshund homolog 1 (Drosophila)-HPRD14525983 
DNMT3BICF | M.HsaIIIBDNA (cytosine-5-)-methyltransferase 3 betaCo-purificationBioGRID15148359 
EFCAB6DJBP | FLJ23588 | HSCBCIP1 | KIAA1672 | dJ185D5.1EF-hand calcium binding domain 6Affinity Capture-WesternBioGRID12612053 
ETV6TEL | TEL/ABLets variant 6-HPRD12527908 
HBP1FLJ16340HMG-box transcription factor 1-HPRD,BioGRID15235594 
HCFC1CFF | HCF-1 | HCF1 | HFC1 | MGC70925 | VCAFhost cell factor C1 (VP16-accessory protein)Affinity Capture-MS
Affinity Capture-Western
Two-hybrid		BioGRID12670868 |15199122 
HDAC1DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1histone deacetylase 1The transcriptional repressor mSin3A interacts with the histone deacetylase 1 protein.BIND9150133 |9150134 
Affinity Capture-MS
Affinity Capture-Western
Co-fractionation
Co-purification		BioGRID9520398 |9804427 
|10220385 |10444591 
|10640275 |11171972 
|11784859 |11931768 
|12091390 |12374985 
|12398767 |12724404 
|12920132 |12943729 
-HPRD11013263 
HDAC2RPD3 | YAF1histone deacetylase 2-HPRD11013263 
The transcriptional repressor mSin3A interacts with histone deacetylase 2.BIND9150134 
Affinity Capture-MS
Affinity Capture-Western		BioGRID9150134 |9804427 
|12091390 |12398767 
|12493763 |12724404 
|12943729 
HDAC3HD3 | RPD3 | RPD3-2histone deacetylase 3-HPRD10944117 
HDAC9DKFZp779K1053 | HD7 | HDAC | HDAC7 | HDAC7B | HDAC9B | HDAC9FL | HDRP | KIAA0744 | MITRhistone deacetylase 9Affinity Capture-Western
Reconstituted Complex		BioGRID11959865 |12590135 
HEY2CHF1 | GRIDLOCK | GRL | HERP1 | HESR2 | HRT2 | MGC10720 | bHLHb32hairy/enhancer-of-split related with YRPW motif 2Affinity Capture-WesternBioGRID11486045 
HTTHD | IT15huntingtinmSin3A interacts with htt. This interaction was modeled on a demonstrated interaction between mSin3A and htt from unspecified species.BIND10823891 
IKZF1Hs.54452 | IK1 | IKAROS | LYF1 | PRO0758 | ZNFN1A1 | hIk-1IKAROS family zinc finger 1 (Ikaros)Affinity Capture-WesternBioGRID10357820 |11959865 
|12015313 
-HPRD10357820 |12015313 
IKZF2HELIOS | MGC34330 | ZNF1A2 | ZNFN1A2IKAROS family zinc finger 2 (Helios)Affinity Capture-WesternBioGRID12015313 
IKZF3AIO | AIOLOS | ZNFN1A3IKAROS family zinc finger 3 (Aiolos)-HPRD10357820 
Affinity Capture-WesternBioGRID12015313 
IKZF4EOS | KIAA1782 | ZNFN1A4IKAROS family zinc finger 4 (Eos)Affinity Capture-WesternBioGRID12015313 
ING1p24ING1c | p33 | p33ING1 | p33ING1b | p47 | p47ING1ainhibitor of growth family, member 1Affinity Capture-WesternBioGRID11784859 
KLF10EGRA | TIEG | TIEG1Kruppel-like factor 10Reconstituted ComplexBioGRID11438660 
KLF11FKLF | FKLF1 | MODY7 | TIEG2 | Tieg3Kruppel-like factor 11Affinity Capture-Western
Reconstituted Complex		BioGRID11438660 |12006497 
KLF13BTEB3 | FKLF2 | NSLP1 | RFLAT-1 | RFLAT1Kruppel-like factor 13Reconstituted ComplexBioGRID11438660 
KLF16BTEB4 | DRRF | NSLP2Kruppel-like factor 16-HPRD,BioGRID12036432 
KLF9BTEB | BTEB1Kruppel-like factor 9Reconstituted ComplexBioGRID11438660 
MAD1L1HsMAD1 | MAD1 | PIG9 | TP53I9 | TXBP181MAD1 mitotic arrest deficient-like 1 (yeast)-HPRD11106735 
MBD2DKFZp586O0821 | DMTase | NY-CO-41methyl-CpG binding domain protein 2Reconstituted Complex
Two-hybrid		BioGRID10950960 
MBD3L1MBD3L | MGC138263 | MGC138269methyl-CpG binding domain protein 3-like 1Affinity Capture-WesternBioGRID15456747 
MNTMAD6 | MXD6 | ROX | bHLHd3MAX binding proteinin vitro
Two-hybrid		BioGRID9184233 
MORF4CSR | CSRB | SEN | SEN1mortality factor 4Affinity Capture-WesternBioGRID12391155 
MORF4L2KIAA0026 | MORFL2 | MRGXmortality factor 4 like 2Affinity Capture-WesternBioGRID12391155 
MTA1-metastasis associated 1Affinity Capture-MSBioGRID12920132 
MTA2DKFZp686F2281 | MTA1L1 | PIDmetastasis associated 1 family, member 2Affinity Capture-MSBioGRID12920132 
MXD1MAD | MAD1 | MGC104659MAX dimerization protein 1Co-crystal Structure
Reconstituted Complex		BioGRID7889570 |11106735 
|15235594 
MXD4MAD4 | MST149 | MSTP149 | bHLHc12MAX dimerization protein 4-HPRD8521822 
NCOR1KIAA1047 | MGC104216 | N-CoR | TRAC1 | hCIT529I10 | hN-CoRnuclear receptor co-repressor 1-HPRD11013263 
Reconstituted ComplexBioGRID11430826 
NCOR2CTG26 | SMRT | SMRTE | SMRTE-tau | TNRC14 | TRAC-1 | TRAC1nuclear receptor co-repressor 2Co-fractionation
Reconstituted Complex		BioGRID10640275 |10944117 
OGTFLJ23071 | HRNT1 | MGC22921 | O-GLCNACO-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)-HPRD,BioGRID12150998 
PFN2D3S1319E | PFLprofilin 2Affinity Capture-WesternBioGRID12391155 
PHBPHB1prohibitinAffinity Capture-WesternBioGRID12466959 
PHF12FLJ34122 | KIAA1523 | MGC131914 | PF1PHD finger protein 12-HPRD,BioGRID11390640 
PMLMYL | PP8675 | RNF71 | TRIM19promyelocytic leukemiaAffinity Capture-Western
Reconstituted Complex		BioGRID11430826 
PTMAMGC104802 | TMSAprothymosin, alphaReconstituted ComplexBioGRID12634383 
RBBP4NURF55 | RBAP48retinoblastoma binding protein 4Affinity Capture-Western
Reconstituted Complex		BioGRID9150133 |9651585 
-HPRD11013263 
RBBP7MGC138867 | MGC138868 | RbAp46retinoblastoma binding protein 7Affinity Capture-Western
Reconstituted Complex		BioGRID9651585 |11784859 
RBPJCBF1 | IGKJRB | IGKJRB1 | KBF2 | MGC61669 | RBP-J | RBPJK | RBPSUH | SUH | cslrecombination signal binding protein for immunoglobulin kappa J regionReconstituted ComplexBioGRID10644367 
RNF12MGC15161 | NY-REN-43 | RLIMring finger protein 12Affinity Capture-WesternBioGRID10431247 
RUNX1T1AML1T1 | CBFA2T1 | CDR | ETO | MGC2796 | MTG8 | MTG8b | ZMYND2runt-related transcription factor 1; translocated to, 1 (cyclin D-related)-HPRD,BioGRID11150306 
ETO interacts with Sin3A.BIND15333839 
SAP130FLJ12761Sin3A-associated protein, 130kDaAffinity Capture-MS
Affinity Capture-Western		BioGRID12724404 
SAP182HOR0202 | MGC27131 | SAP18pSin3A-associated protein, 18kDaReconstituted ComplexBioGRID9651585 
SAP30-Sin3A-associated protein, 30kDa-HPRD11013263 
Affinity Capture-MS
Affinity Capture-Western
Co-purification
Reconstituted Complex		BioGRID9651585 |9702189 
|10444591 |11390640 
|11784859 |12724404 
SATB1-SATB homeobox 1Co-fractionationBioGRID12374985 
SETDB1ESET | KG1T | KIAA0067 | KMT1ESET domain, bifurcated 1-HPRD,BioGRID12398767 
SIN3BKIAA0700SIN3 homolog B, transcription regulator (yeast)-HPRD10357820 
SKISKVv-ski sarcoma viral oncogene homolog (avian)Reconstituted ComplexBioGRID11430826 
SMARCA2BAF190 | BRM | FLJ36757 | MGC74511 | SNF2 | SNF2L2 | SNF2LA | SWI2 | Sth1p | hBRM | hSNF2aSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2Co-purification
Reconstituted Complex		BioGRID11238380 
SMARCA4BAF190 | BRG1 | FLJ39786 | SNF2 | SNF2-BETA | SNF2L4 | SNF2LB | SWI2 | hSNF2bSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4Affinity Capture-Western
Co-purification
Reconstituted Complex		BioGRID11238380 |11784859 
SMARCB1BAF47 | INI1 | RDT | SNF5 | SNF5L1 | Sfh1p | Snr1 | hSNFSSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1Co-purificationBioGRID11238380 
SMARCC1BAF155 | CRACC1 | Rsc8 | SRG3 | SWI3SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1Affinity Capture-Western
Reconstituted Complex		BioGRID11238380 |11784859 
SNW1Bx42 | MGC119379 | NCOA-62 | PRPF45 | Prp45 | SKIIP | SKIPSNW domain containing 1Reconstituted ComplexBioGRID10644367 
SUDS3FLJ00052 | MGC104711 | SAP45 | SDS3suppressor of defective silencing 3 homolog (S. cerevisiae)Affinity Capture-MS
Affinity Capture-Western
Reconstituted Complex
Two-hybrid		BioGRID11909966 |12724404 
TAL1SCL | TCL5 | bHLHa17 | tal-1T-cell acute lymphocytic leukemia 1Affinity Capture-Western
Reconstituted Complex		BioGRID10688671 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53p53 interacts with mSin3A. This interaction was modeled on a demonstrated interaction between human p53 and mSin3A from an unspecified species.BIND10823891 
ZBTB16PLZF | ZNF145zinc finger and BTB domain containing 16-HPRD9627120 |11719366 
Affinity Capture-Western
Reconstituted Complex
Two-hybrid		BioGRID9627120 |9765306 
|11719366 
Sin3A interacts with PLZF. This interaction was modelled on a demonstrated interaction between mSin3A and PLZF from unspecified species.BIND9486654 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-138726732m8hsa-miR-138brainAGCUGGUGUUGUGAAUC
hsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-144800806m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-1497131Ahsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-183718724m8hsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-204/211939945m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-3292733m8hsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-3308298361A,m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-4319149201Ahsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-493-5p794800m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-9936942m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.