Gene Page: STEAP2

Summary
GeneID  261729
Symbol  STEAP2
Synonyms  IPCA1|PCANAP1|PUMPCn|STAMP1|STMP
Description  six transmembrane epithelial antigen of the prostate 2
See related  HGNC:17885|MIM:605094|Ensembl:ENSG00000157214|HPRD:05481|
Locus tag  -
Gene type  protein-coding
Map location  7q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003824catalytic activityIEA-
GO:0005488bindingIEA-
GO:0005506iron ion bindingIEA-
GO:0005507copper ion bindingIEA-
GO:0005215transporter activityIDA12095985 
GO:0005215transporter activityISS-
GO:0009055electron carrier activityIEA-
GO:0016491oxidoreductase activityIEA-
GO:0046872metal ion bindingIEA-
GO:0050660FAD bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0045055regulated secretory pathwayIDANeurotransmitter (GO term level: 7)12095985 
GO:0045055regulated secretory pathwayISSNeurotransmitter (GO term level: 7)-
GO:0009725response to hormone stimulusIDA12095985 
GO:0009725response to hormone stimulusISS-
GO:0008152metabolic processIEA-
GO:0006826iron ion transportIEA-
GO:0006811ion transportIEA-
GO:0006897endocytosisIDA12095985 
GO:0006897endocytosisISS-
GO:0006893Golgi to plasma membrane transportIDA12095985 
GO:0006893Golgi to plasma membrane transportISS-
GO:0022900electron transport chainIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolIDA12095985 
GO:0005829cytosolISS-
GO:0005769early endosomeIDA12095985 
GO:0005769early endosomeISS-
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIDA12095985 
GO:0005886plasma membraneISS-
GO:0030173integral to Golgi membraneIDA12095985 
GO:0030173integral to Golgi membraneISS-
GO:0010008endosome membraneIEA-
GO:0030140trans-Golgi network transport vesicleIDA12095985 
GO:0030140trans-Golgi network transport vesicleISS-
GO:0042598vesicular fractionIDA12095985 
GO:0042598vesicular fractionISS-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3624424481Ahsa-miR-362AAUCCUUGGAACCUAGGUGUGAGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.