Gene Page: PLDN

Summary
GeneID  26258
Symbol  PLDN
Synonyms  PA|PALLID
Description  pallidin homolog (mouse)
See related  HGNC:8549|MIM:604310|Ensembl:ENSG00000104164|HPRD:16055|
Locus tag  -
Gene type  protein-coding
Map location  15q21.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 1.5219 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0042802identical protein bindingIPI15102850 
GO:0030349syntaxin-13 bindingTAS10610180 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016081synaptic vesicle docking during exocytosisNASSynap (GO term level: 10)10610180 
GO:0006944membrane fusionIEA-
GO:0043473pigmentationIEA-
GO:0030318melanocyte differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0012505endomembrane systemIEA-
GO:0005575cellular_componentND-
GO:0005737cytoplasmIEA-
GO:0005768endosomeIEA-
GO:0016020membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTA1ACTA | ASMA | CFTD | CFTD1 | CFTDM | MPFD | NEM1 | NEM2 | NEM3actin, alpha 1, skeletal muscle-HPRD12019270 
AGGF1FLJ10283 | GPATC7 | GPATCH7 | HSU84971 | HUS84971 | VG5Qangiogenic factor with G patch and FHA domains 1Two-hybridBioGRID16189514 
BLOC1S1BLOS1 | FLJ39337 | FLJ97089 | GCN5L1 | MGC87455 | MICoA | RT14biogenesis of lysosomal organelles complex-1, subunit 1-HPRD,BioGRID15102850 
Pallidin interacts with BLOS1.BIND15102850 
BLOC1S2BLOS2 | FLJ30135 | MGC10120 | RP11-316M21.4biogenesis of lysosomal organelles complex-1, subunit 2-HPRD,BioGRID15102850 
BLOC1S3BLOS3 | FLJ26641 | FLJ26676 | HPS8 | RPbiogenesis of lysosomal organelles complex-1, subunit 3-HPRD,BioGRID15102850 
C18orf24MGC10200 | Ska1chromosome 18 open reading frame 24Two-hybridBioGRID16189514 
C1orf190FLJ25163chromosome 1 open reading frame 190Two-hybridBioGRID16189514 
CCDC53CGI-116coiled-coil domain containing 53Two-hybridBioGRID16189514 
CNOBCAS4L | FLJ11230cappuccino homolog (mouse)Pallidin interacts with Cappuccino.BIND15102850 
-HPRD,BioGRID15102850 
DTNBP1DBND | DKFZp564K192 | FLJ30031 | HPS7 | MGC20210 | My031 | SDYdystrobrevin binding protein 1Pallidin interacts with Dysbindin.BIND15102850 
-HPRD,BioGRID15102850 
EPS8-epidermal growth factor receptor pathway substrate 8Two-hybridBioGRID16189514 
EXOC8EXO84 | Exo84p | SEC84exocyst complex component 8Two-hybridBioGRID16189514 
MUTEDDKFZp686E2287 | MUmuted homolog (mouse)-HPRD,BioGRID12019270 
NDC80HEC | HEC1 | KNTC2 | TID3 | hsNDC80NDC80 homolog, kinetochore complex component (S. cerevisiae)Two-hybridBioGRID16189514 
PLDNPA | PALLIDpallidin homolog (mouse)Two-hybridBioGRID15102850 |16189514 
Pallidin interacts with Pallidin.BIND15102850 
PLEKHF2FLJ13187 | PHAFIN2 | ZFYVE18pleckstrin homology domain containing, family F (with FYVE domain) member 2Two-hybridBioGRID16189514 
SLC4A1AE1 | BND3 | CD233 | DI | EMPB3 | EPB3 | FR | MGC116750 | MGC116753 | MGC126619 | MGC126623 | RTA1A | SW | WD | WD1 | WRsolute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)-HPRD2968981 
SNAPINSNAPAPSNAP-associated protein-HPRD,BioGRID15102850 
STX12MGC51957 | STX13 | STX14syntaxin 12-HPRD,BioGRID10610180 
WDYHV1C8orf32 | FLJ10204WDYHV motif containing 1Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/9816131619m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-124.18086m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/50679861A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-19616121618m8hsa-miR-196aUAGGUAGUUUCAUGUUGUUGG
hsa-miR-196bUAGGUAGUUUCCUGUUGUUGG
miR-383161816251A,m8hsa-miR-383brainAGAUCAGAAGGUGAUUGUGGCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.