Gene Page: CNNM3

Summary
GeneID  26505
Symbol  CNNM3
Synonyms  ACDP3|DKFZp434I1016|FLJ20018
Description  cyclin M3
See related  HGNC:104|MIM:607804|Ensembl:ENSG00000168763|HPRD:07419|
Locus tag  -
Gene type  protein-coding
Map location  2p12-p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006811ion transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
HNRNPKCSBP | FLJ41122 | HNRPK | TUNPheterogeneous nuclear ribonucleoprotein KTwo-hybridBioGRID16189514 
KRTAP4-12KAP4.12 | KRTAP4.12keratin associated protein 4-12Two-hybridBioGRID16189514 
MDFII-MF | I-mfaMyoD family inhibitorTwo-hybridBioGRID16189514 
PTP4A2HH13 | HH7-2 | HU-PP-1 | OV-1 | PRL-2 | PRL2 | PTP4A | PTPCAAX2 | ptp-IV1a | ptp-IV1bprotein tyrosine phosphatase type IVA, member 2Affinity Capture-MSBioGRID17353931 
PTP4A3PRL-3 | PRL-R | PRL3protein tyrosine phosphatase type IVA, member 3Affinity Capture-MSBioGRID17353931 
RBPMSHERMESRNA binding protein with multiple splicingTwo-hybridBioGRID16189514 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-143264270m8hsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-1825685741Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-965675741A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.