Gene Page: RND1

Summary
GeneID  27289
Symbol  RND1
Synonyms  ARHS|FLJ42294|RHO6|RHOS
Description  Rho family GTPase 1
See related  HGNC:18314|MIM:609038|Ensembl:ENSG00000172602|HPRD:12357|
Locus tag  -
Gene type  protein-coding
Map location  12q12-q13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityNAS9531558 |11095956 
GO:0005525GTP bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016322neuron remodelingIDAneuron, axon, dendrite (GO term level: 11)11095956 
GO:0007162negative regulation of cell adhesionIDA9531558 
GO:0007015actin filament organizationIDA9531558 |11095956 
GO:0007264small GTPase mediated signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIEA-
GO:0005622intracellularIEA-
GO:0005737cytoplasmIEA-
GO:0005912adherens junctionIDA9531558 
GO:0005886plasma membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGAP5GFI2 | RhoGAP5 | p190-BRho GTPase activating protein 5Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID12842009 
GRB7-growth factor receptor-bound protein 7-HPRD,BioGRID10664463 
PDE6DPDEDphosphodiesterase 6D, cGMP-specific, rod, delta-HPRD,BioGRID11786539 |11980706 
PLXNA1NOV | NOVP | PLEXIN-A1 | PLXN1plexin A1-HPRD11108845 
PLXNB1KIAA0407 | MGC149167 | PLEXIN-B1 | PLXN5 | SEPplexin B1Plexin-B1 interacts with Rnd1.BIND15297673 
-HPRD,BioGRID12730235 
PLXNB2KIAA0315 | MM1 | Nbla00445 | PLEXB2 | dJ402G11.3plexin B2Two-hybridBioGRID12730235 
UBXN11COA-1 | DKFZp686F04228 | PP2243 | SOC | SOCI | UBXD5UBX domain protein 11-HPRD,BioGRID11940653 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1365595651Ahsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
miR-29659665m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.