Gene Page: HTRA2

Summary
GeneID  27429
Symbol  HTRA2
Synonyms  OMI|PARK13|PRSS25
Description  HtrA serine peptidase 2
See related  HGNC:14348|MIM:606441|Ensembl:ENSG00000115317|HPRD:05919|
Locus tag  -
Gene type  protein-coding
Map location  2p12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 3 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004252serine-type endopeptidase activityTASglutamate (GO term level: 7)10873535 
GO:0008233peptidase activityIEA-
GO:0051082unfolded protein bindingNAS10644717 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0048666neuron developmentIEAneuron (GO term level: 9)-
GO:0030900forebrain developmentIEABrain (GO term level: 8)-
GO:0006508proteolysisTAS10873535 
GO:0006950response to stressTAS10971580 
GO:0008629induction of apoptosis by intracellular signalsIEA-
GO:0007628adult walking behaviorIEA-
GO:0007005mitochondrion organizationIEA-
GO:0006915apoptosisIEA-
GO:0040014regulation of multicellular organism growthIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneTAS10644717 
GO:0005634nucleusTAS10971580 
GO:0005739mitochondrionIEA-
GO:0005758mitochondrial intermembrane spaceIDA15044455 
GO:0005783endoplasmic reticulumNAS10995577 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0031966mitochondrial membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APPAAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2amyloid beta (A4) precursor proteinHtrA2 interacts with APP.BIND15036614 
BIRC2API1 | HIAP2 | Hiap-2 | MIHB | RNF48 | cIAP1baculoviral IAP repeat-containing 2-HPRD,BioGRID11604410 
BIRC3AIP1 | API2 | CIAP2 | HAIP1 | HIAP1 | MALT2 | MIHC | RNF49baculoviral IAP repeat-containing 3Reconstituted ComplexBioGRID12865429 
BIRC6APOLLON | BRUCE | FLJ13726 | FLJ13786 | KIAA1289baculoviral IAP repeat-containing 6BRUCE interacts with HtrA2.BIND15200957 
Apollon interacts with HtrA2.BIND15300255 
DIABLODIABLO-S | FLJ10537 | FLJ25049 | SMAC | SMAC3diablo homolog (Drosophila)-HPRD,BioGRID11604410 
MAPK14CSBP1 | CSBP2 | CSPB1 | EXIP | Mxi2 | PRKM14 | PRKM15 | RK | SAPK2A | p38 | p38ALPHAmitogen-activated protein kinase 14-HPRD,BioGRID10644717 
XIAPAPI3 | BIRC4 | ILP1 | MIHA | XLP2X-linked inhibitor of apoptosis-HPRD,BioGRID11604410 
XIAP interacts with HtrA2.BIND15300255 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-28548554m8hsa-miR-28brainAAGGAGCUCACAGUCUAUUGAG
miR-4101631691Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-485-5p5655721A,m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.