Gene Page: CCDC141

Summary
GeneID  285025
Symbol  CCDC141
Synonyms  FLJ26337|FLJ39502|MGC134803
Description  coiled-coil domain containing 141
See related  HGNC:26821|Ensembl:ENSG00000163492|HPRD:08257|
Locus tag  -
Gene type  protein-coding
Map location  2q31.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI12812986 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DISC1C1orf136 | FLJ13381 | FLJ21640 | FLJ25311 | FLJ41105 | KIAA0457 | SCZD9disrupted in schizophrenia 1Two-hybridBioGRID12812986 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2062502571A,m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-268928991A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-409-3p249255m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.