Gene Page: C3orf38

Summary
GeneID  285237
Symbol  C3orf38
Synonyms  FLJ54270|MGC26717
Description  chromosome 3 open reading frame 38
See related  HGNC:28384|Ensembl:ENSG00000179021|HPRD:14509|
Locus tag  -
Gene type  protein-coding
Map location  3p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006915apoptosisIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-37524301Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.