Gene Page: C13orf15

Summary
GeneID  28984
Symbol  C13orf15
Synonyms  KIAA0564|MGC87338|RGC-32|RGC32|bA157L14.2
Description  chromosome 13 open reading frame 15
See related  HGNC:20369|MIM:610077|Ensembl:ENSG00000102760|HPRD:17970|
Locus tag  -
Gene type  protein-coding
Map location  13q14.11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000079regulation of cyclin-dependent protein kinase activityTAS9756947 
GO:0007049cell cycleIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005813centrosomeIEA-
GO:0005634nucleusIEA-
GO:0005737cytoplasmTAS9756947 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CDC2CDC28A | CDK1 | DKFZp686L20222 | MGC111195cell division cycle 2, G1 to S and G2 to M-HPRD11687586 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-5p198204m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-4103123181Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.