Gene Page: DNAJC15

Summary
GeneID  29103
Symbol  DNAJC15
Synonyms  DNAJD1|HSD18|MCJ
Description  DnaJ (Hsp40) homolog, subfamily C, member 15
See related  HGNC:20325|Ensembl:ENSG00000120675|HPRD:13238|
Locus tag  -
Gene type  protein-coding
Map location  13q14.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0031072heat shock protein bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA18029348 
GO:0005737cytoplasmIDA18029348 
GO:0016021integral to membraneIEA-
GO:0005925focal adhesionIDA18029348 
GO:0005886plasma membraneIDA18029348 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-485-3p7817871Ahsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.