Gene Page: GRM2

Summary
GeneID  2912
Symbol  GRM2
Synonyms  GLUR2|GPRC1B|MGLUR2|mGlu2
Description  glutamate receptor, metabotropic 2
See related  HGNC:4594|MIM:604099|Ensembl:ENSG00000164082|HPRD:04977|
Locus tag  -
Gene type  protein-coding
Map location  3p21.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenia, schizophrenias]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)7620613 
GO:0007186G-protein coupled receptor protein signaling pathwayIEA-
GO:0007194negative regulation of adenylate cyclase activityTAS7620613 
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS7620613 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GNAQG-ALPHA-q | GAQguanine nucleotide binding protein (G protein), q polypeptide-HPRD8863838 
RESTNRSF | XBRRE1-silencing transcription factorNRSF/REST interacts with mGluR2 promoter in the region of the NRSE/RE1 (neuron restrictive silencer element).BIND15035981 
RGS12DKFZp761K1617 | DKFZp761K1817regulator of G-protein signaling 12-HPRD9651375 
SMARCA4BAF190 | BRG1 | FLJ39786 | SNF2 | SNF2-BETA | SNF2L4 | SNF2LB | SWI2 | hSNF2bSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4BRG1 interacts with mGluR2 promoter.BIND15035981 
SMARCC2BAF170 | CRACC2 | Rsc8SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2BAF170 interacts with mGluR2 promoter.BIND15035981 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-25/32/92/363/36789951Ahsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.