Gene Page: STRN4

Summary
GeneID  29888
Symbol  STRN4
Synonyms  FLJ35594|ZIN|zinedin
Description  striatin, calmodulin binding protein 4
See related  HGNC:15721|Ensembl:ENSG00000090372|HPRD:18125|
Locus tag  -
Gene type  protein-coding
Map location  19q13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0631 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005516calmodulin bindingTAS10748158 
GO:0005198structural molecule activityTAS10748158 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)10748158 
GO:0007165signal transductionTAS10748158 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005624membrane fractionTAS10748158 
GO:0005737cytoplasmTAS10748158 
GO:0016020membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AK5AK6 | MGC33326adenylate kinase 5Two-hybridBioGRID16169070 
ASNSTS11asparagine synthetaseTwo-hybridBioGRID16169070 
BAT1D6S81E | DDX39B | UAP56HLA-B associated transcript 1Two-hybridBioGRID16169070 
CAV1CAV | MSTP085 | VIP21caveolin 1, caveolae protein, 22kDa-HPRD11707266 
CLDN12-claudin 12Two-hybridBioGRID16169070 
CTTNBP2C7orf8 | CORTBP2 | FLJ34229 | KIAA1758 | MGC104579 | Orf4cortactin binding protein 2Affinity Capture-MSBioGRID18782753 
CTTNBP2NLDKFZp547A023 | FLJ13278CTTNBP2 N-terminal likeAffinity Capture-MSBioGRID18782753 
ECSITSITPECECSIT homolog (Drosophila)Two-hybridBioGRID16169070 
FAM40AFLJ14743 | KIAA1761 | MGC148091 | RP4-773N10.1family with sequence similarity 40, member AAffinity Capture-MSBioGRID18782753 
GDF9-growth differentiation factor 9Two-hybridBioGRID16169070 
KLHDC2HCLP-1 | LCPkelch domain containing 2Two-hybridBioGRID16169070 
MCCDKFZp762O1615 | FLJ38893 | FLJ46755 | MCC1mutated in colorectal cancersAffinity Capture-MSBioGRID17353931 
MOBKL32C4D | CGI-95 | MGC12264 | MOB1 | MOB3 | PREI3MOB1, Mps One Binder kinase activator-like 3 (yeast)Affinity Capture-MSBioGRID18782753 
MTG1GTP | GTPBP7 | RP11-108K14.2mitochondrial GTPase 1 homolog (S. cerevisiae)Two-hybridBioGRID16169070 
NBEABCL8B | LYST2neurobeachinTwo-hybridBioGRID16169070 
PDCD10CCM3 | MGC1212 | MGC24477 | TFAR15programmed cell death 10Affinity Capture-MSBioGRID18782753 
PI4KAFLJ16556 | PI4K-ALPHA | PIK4CA | pi4K230phosphatidylinositol 4-kinase, catalytic, alphaTwo-hybridBioGRID16169070 
PPP2CAPP2Ac | PP2CA | RP-Cprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoformAffinity Capture-MSBioGRID18782753 
PPP2CBPP2CBprotein phosphatase 2 (formerly 2A), catalytic subunit, beta isoformAffinity Capture-MSBioGRID18782753 
PPP2R1AMGC786 | PR65Aprotein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoformAffinity Capture-MSBioGRID18782753 
RP5-1000E10.4DKFZp686A0768 | FLJ21168 | SIKEsuppressor of IKK epsilonAffinity Capture-MSBioGRID18782753 
RP6-213H19.1MASK | MST4serine/threonine protein kinase MST4Affinity Capture-MSBioGRID18782753 
SLC25A6AAC3 | ANT3 | ANT3Y | MGC17525solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6Two-hybridBioGRID16169070 
STK24MST-3 | MST3 | MST3B | STE20 | STK3serine/threonine kinase 24 (STE20 homolog, yeast)Affinity Capture-MSBioGRID17353931 |18782753 
STK25DKFZp686J1430 | SOK1 | YSK1serine/threonine kinase 25 (STE20 homolog, yeast)Affinity Capture-MSBioGRID18782753 
STRNMGC125642 | SG2NAstriatin, calmodulin binding proteinAffinity Capture-MSBioGRID18782753 
STRN3SG2NAstriatin, calmodulin binding protein 3Affinity Capture-MSBioGRID18782753 
TRAF3IP3DJ434O14.3 | FLJ44151 | MGC117354 | MGC163289 | T3JAMTRAF3 interacting protein 3Affinity Capture-MSBioGRID18782753 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-128691697m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-238378431Ahsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-291301371A,m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-377694700m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-485-5p7581m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.