Gene Page: TLX1

Summary
GeneID  3195
Symbol  TLX1
Synonyms  HOX11|MGC163402|TCL3
Description  T-cell leukemia homeobox 1
See related  HGNC:5056|MIM:186770|Ensembl:ENSG00000107807|HPRD:01728|
Locus tag  -
Gene type  protein-coding
Map location  10q24
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0046982protein heterodimerization activityIEA-
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007417central nervous system developmentIEABrain (GO term level: 6)-
GO:0030182neuron differentiationIEAneuron (GO term level: 8)-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0008284positive regulation of cell proliferationIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0045165cell fate commitmentIEA-
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
GO:0048536spleen developmentIEA-
GO:0048645organ formationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PPP1CCPPP1Gprotein phosphatase 1, catalytic subunit, gamma isoformAffinity Capture-Western
Reconstituted Complex		BioGRID9009195 
PPP2CAPP2Ac | PP2CA | RP-Cprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoformAffinity Capture-Western
Reconstituted Complex
Two-hybrid		BioGRID9009195 
PPP2CBPP2CBprotein phosphatase 2 (formerly 2A), catalytic subunit, beta isoformAffinity Capture-Western
Reconstituted Complex
Two-hybrid		BioGRID9009195 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-409-5p8108161Ahsa-miR-409-5pAGGUUACCCGAGCAACUUUGCA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.