Gene Page: HTR1F

Summary
GeneID  3355
Symbol  HTR1F
Synonyms  5-HT1F|5HT6|HTR1EL|MR77
Description  5-hydroxytryptamine (serotonin) receptor 1F
See related  HGNC:5292|MIM:182134|Ensembl:ENSG00000179097|HPRD:01637|
Locus tag  -
Gene type  protein-coding
Map location  3p12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004993serotonin receptor activityTASserotonin, Neurotransmitter (GO term level: 8)8380639 
GO:0004872receptor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)8380639 
GO:0007187G-protein signaling, coupled to cyclic nucleotide second messengerTAS8380639 
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS8380639 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GNAO1DKFZp686O0962 | G-ALPHA-o | GNAOguanine nucleotide binding protein (G protein), alpha activating activity polypeptide O-HPRD11916537 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1532352421A,m8hsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-4482362421Ahsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.