Gene Page: NAT8L

Summary
GeneID  339983
Symbol  NAT8L
Synonyms  CML3|FLJ37478|Hcml3|MGC117272|NAT8-LIKE
Description  N-acetyltransferase 8-like (GCN5-related, putative)
See related  HGNC:26742|MIM:610647|Ensembl:ENSG00000185818|HPRD:08224|
Locus tag  -
Gene type  protein-coding
Map location  4p16.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.627 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016740transferase activityIEA-
GO:0008415acyltransferase activityIEA-
GO:0008080N-acetyltransferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008152metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-218337343m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-278568621Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-330645651m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-488173917451Ahsa-miR-488CCCAGAUAAUGGCACUCUCAA
miR-495173217381Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.