Gene Page: SYT10

Summary
GeneID  341359
Symbol  SYT10
Synonyms  MGC119436|MGC119437
Description  synaptotagmin X
See related  HGNC:19266|Ensembl:ENSG00000110975|HPRD:15460|
Locus tag  -
Gene type  protein-coding
Map location  12p11.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005215transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006810transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0008021synaptic vesicleIEASynap, Neurotransmitter (GO term level: 12)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0030054cell junctionIEA-
GO:0031410cytoplasmic vesicleIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
SYT10MGC119436 | MGC119437synaptotagmin XAffinity Capture-WesternBioGRID10531343 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-261801871A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-9947953m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.