Gene Page: SLC35B2

Summary
GeneID  347734
Symbol  SLC35B2
Synonyms  PAPST1|SLL|UGTrel4
Description  solute carrier family 35, member B2
See related  HGNC:16872|MIM:610788|Ensembl:ENSG00000157593|HPRD:11576|
Locus tag  RP1-302G2.3
Gene type  protein-coding
Map location  6p12.1-p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004871signal transducer activityIMP12761501 
GO:00469643'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activityIDA12716889 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006810transportIEA-
GO:0043123positive regulation of I-kappaB kinase/NF-kappaB cascadeIMP12761501 
GO:00469633'-phosphoadenosine 5'-phosphosulfate transportIDA12716889 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIDA12716889 
GO:0016020membraneIDA12716889 
GO:0016021integral to membraneNAS12716889 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.11691761A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5061691751Ahsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.