Gene Page: IL6ST

Summary
GeneID  3572
Symbol  IL6ST
Synonyms  CD130|CDw130|GP130|GP130-RAPS|IL6R-beta
Description  interleukin 6 signal transducer (gp130, oncostatin M receptor)
See related  HGNC:6021|MIM:600694|Ensembl:ENSG00000134352|HPRD:02824|
Locus tag  -
Gene type  protein-coding
Map location  5q11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 2.34 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
LPCAT20.740.78
SLC9A90.740.77
CALCRL0.740.79
SLC30A10.740.72
PTPRC0.730.75
CD1640.730.72
CTSS0.730.73
CTSO0.730.78
LY750.720.71
EVI2B0.720.71
Top 10 negatively co-expressed genes
PLEKHO1-0.49-0.50
SNHG12-0.46-0.55
AC132872.1-0.45-0.54
SH2B2-0.44-0.46
MICAL1-0.43-0.34
RPAIN-0.43-0.41
NR2C2AP-0.43-0.45
ZBTB12-0.43-0.27
CCDC28B-0.42-0.50
MYCN-0.42-0.24
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0004872receptor activityTAS10954742 
GO:0005515protein bindingIPI10982829 |11251120 
GO:0004924oncostatin-M receptor activityTAS8999038 
GO:0004915interleukin-6 receptor activityTAS8390097 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0005977glycogen metabolic processIEA-
GO:0007166cell surface receptor linked signal transductionTAS8999038 
GO:0008284positive regulation of cell proliferationIEA-
GO:0008593regulation of Notch signaling pathwayIEA-
GO:0006955immune responseTAS2261637 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005886plasma membraneTAS2261637 |8999038 
GO:0005887integral to plasma membraneTAS2261637 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptorAffinity Capture-WesternBioGRID15129430 
CDK9C-2k | CDC2L4 | CTK1 | PITALRE | TAKcyclin-dependent kinase 9-HPRD,BioGRID12386808 
CNTFHCNTFciliary neurotrophic factor-HPRD12643274 
CNTFRMGC1774ciliary neurotrophic factor receptor-HPRD11285233 
Affinity Capture-Western
Reconstituted Complex		BioGRID12707266 
CTF1CT-1 | CT1cardiotrophin 1-HPRD11834704 
ERBB2CD340 | HER-2 | HER-2/neu | HER2 | NEU | NGL | TKR1v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)-HPRD,BioGRID11821958 
ERBB3ErbB-3 | HER3 | LCCS2 | MDA-BF-1 | MGC88033 | c-erbB-3 | c-erbB3 | erbB3-S | p180-ErbB3 | p45-sErbB3 | p85-sErbB3v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)-HPRD,BioGRID11821958 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2Affinity Capture-Western
Reconstituted Complex		BioGRID9013873 
HCKJTK9hemopoietic cell kinase-HPRD,BioGRID11689697 
IL31RACRL | CRL3 | GLM-R | GLMR | GPL | IL-31RA | MGC125346 | PRO21384interleukin 31 receptor A-HPRD14504285 |15184896 
IL6BSF2 | HGF | HSF | IFNB2 | IL-6interleukin 6 (interferon, beta 2)-HPRD14557255 
IL6RCD126 | IL-6R-1 | IL-6R-alpha | IL6RA | MGC104991interleukin 6 receptor-HPRD,BioGRID2788034 
JAK1JAK1A | JAK1B | JTK3Janus kinase 1 (a protein tyrosine kinase)-HPRD,BioGRID11468294 |11742534 
JAK2JTK10Janus kinase 2 (a protein tyrosine kinase)Affinity Capture-WesternBioGRID9388212 
LIFCDF | DIA | HILDAleukemia inhibitory factor (cholinergic differentiation factor)-HPRD12707269 
LIFRCD118 | FLJ98106 | FLJ99923 | LIF-R | SJS2 | STWS | SWSleukemia inhibitory factor receptor alpha-HPRD,BioGRID12047380 
OSMMGC20461oncostatin M-HPRD8999038 
OSMRMGC150626 | MGC150627 | MGC75127 | OSMRBoncostatin M receptorAffinity Capture-WesternBioGRID8999038 
-HPRD9188471 
PIK3CGPI3CG | PI3K | PI3Kgamma | PIK3phosphoinositide-3-kinase, catalytic, gamma polypeptide-HPRD10579793 
PIK3R1GRB1 | p85 | p85-ALPHAphosphoinositide-3-kinase, regulatory subunit 1 (alpha)Affinity Capture-WesternBioGRID10579793 
PRKCDMAY1 | MGC49908 | PKCD | nPKC-deltaprotein kinase C, delta-HPRD,BioGRID12361954 
PKC-delta interacts with gp130. This interaction was modelled on a demonstrated interaction between mouse PKC-delta and human gp130.BIND12361954 
PTPN11BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2protein tyrosine phosphatase, non-receptor type 11-HPRD,BioGRID10946280 
-HPRD9195977 
PTPN6HCP | HCPH | HPTP1C | PTP-1C | SH-PTP1 | SHP-1 | SHP-1L | SHP1protein tyrosine phosphatase, non-receptor type 6-HPRD,BioGRID10800945 
SOCS3ATOD4 | CIS3 | Cish3 | MGC71791 | SOCS-3 | SSI-3 | SSI3suppressor of cytokine signaling 3-HPRD,BioGRID10946280 |12403768 
STAT3APRF | FLJ20882 | HIES | MGC16063signal transducer and activator of transcription 3 (acute-phase response factor)-HPRD,BioGRID12361954 
gp130 interacts with an unspecified isoform of Stat3.BIND12361954 
TLE1ESG | ESG1 | GRG1transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)-HPRD,BioGRID12030375 
TYK2JTK1tyrosine kinase 2-HPRD,BioGRID9388212 
VAV1VAVvav 1 guanine nucleotide exchange factor-HPRD,BioGRID9013873 
Vav interacts with gp130.BIND9013873 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-192/2154784841Ahsa-miR-192CUGACCUAUGAAUUGACAGCC
hsa-miR-215AUGACCUAUGAAUUGACAGAC
miR-3785855911Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-4945805871A,m8hsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.