Gene Page

Home
Datasets
Search
Analysis & Tools
Documents
About SZGR
Quick search: (e.g. 207 or AKT)

Association Linkage Expression Literature GO_Annotation Gene Network miRNA Targets

Gene Ranking Integration

Association Linkage Expression Literature GO_Annotation Gene Network miRNA Targets Datasets Gene Ranking

Release Site Map Support Contact us

Gene Page: JUN

Summary

GeneID

3725

Symbol

JUN

Synonyms

AP-1|AP1|c-Jun

Description

jun oncogene

Locus tag

Gene type

protein-coding

Map location

1p32-p31

Gene in Data Sources

Gene set name

Method of gene set

Evidence

Info

GSMA_IIA

genome scan meta-analysis (All samples)

Psr: 0.02692

Literature

High-throughput literature-search

Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]

Click to show detail

General Gene Expression (microarray) ?

Gene Expression in Brain Regions (new)

Top co-expressed genes in Brain Regions (new)

Gene

Pearson's Correlation

Spearman's Correlation

Top 10 positively co-expressed genes

ZDHHC14

0.80

0.83

KCNC4

0.79

0.82

LENG4

0.79

0.82

GPR61

0.79

0.84

RAPGEFL1

0.78

0.82

P2RX5

0.77

0.82

GALNTL4

0.76

0.82

C19orf28

0.76

NDRG4

0.76

0.83

SLC7A4

0.76

0.83

Top 10 negatively co-expressed genes

UXT

-0.41

-0.42

SNRPG

-0.41

-0.52

RPL24

-0.40

-0.44

RPL35A

-0.40

-0.49

RBMX2

-0.39

-0.45

RPS20

-0.39

-0.52

RPS6

-0.39

-0.45

RPS16P1

-0.39

-0.50

RPL37

-0.39

-0.53

RPS25P8

-0.39

-0.48

Gene Ontology

Molecular function

GO term

Evidence

Neuro keywords

PubMed ID

GO:0003700

transcription factor activity

TAS

2825349 |10973489

GO:0003702

RNA polymerase II transcription factor activity

TAS

9443941

GO:0043565

sequence-specific DNA binding

IEA

GO:0046983

protein dimerization activity

IEA

Biological process

GO term

Evidence

Neuro keywords

PubMed ID

GO:0006355

regulation of transcription, DNA-dependent

IEA

GO:0009987

cellular process

IEA

GO:0035026

leading edge cell differentiation

IEA

GO:0031953

negative regulation of protein amino acid autophosphorylation

IEA

GO:0045944

positive regulation of transcription from RNA polymerase II promoter

IEA

GO:0051726

regulation of cell cycle

IEA

Cellular component

GO term

Evidence

Neuro keywords

PubMed ID

GO:0000228

nuclear chromosome

TAS

10918580

GO:0005829

cytosol

EXP

9030721

GO:0005634

nucleus

IEA

GO:0005667

transcription factor complex

IEA

Protein-protein Interactions

Shown by network

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD,BioGRID	8798722 \|9211894
ASCC1	ASC1p50 \| CGI-18 \| RP11-150D20.4	activating signal cointegrator 1 complex subunit 1	Reconstituted Complex Two-hybrid	BioGRID	12077347
ASCC2	ASC1p100	activating signal cointegrator 1 complex subunit 2	Reconstituted Complex Two-hybrid	BioGRID	12077347
ASCC3	ASC1p200 \| DJ467N11.1 \| HELIC1 \| MGC26074 \| RNAH \| dJ121G13.4	activating signal cointegrator 1 complex subunit 3	Reconstituted Complex Two-hybrid	BioGRID	12077347
ATF1	EWS-ATF1 \| FUS/ATF-1 \| TREB36	activating transcription factor 1	-	HPRD,BioGRID	8570175
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	Affinity Capture-Western in vitro in vivo Reconstituted Complex	BioGRID	1827203 \|2320002 \|8027667
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	-	HPRD	1827203 \|2320002 \|9445037
ATF3	-	activating transcription factor 3	-	HPRD	8649793 \|14667575
ATF3	-	activating transcription factor 3	Affinity Capture-Western	BioGRID	8622660 \|14667575
ATF4	CREB-2 \| CREB2 \| TAXREB67 \| TXREB	activating transcription factor 4 (tax-responsive enhancer element B67)	-	HPRD,BioGRID	1827203
BATF	B-ATF \| BATF1 \| SFA-2	basic leucine zipper transcription factor, ATF-like	-	HPRD,BioGRID	8570175
BCL3	BCL4 \| D19S37	B-cell CLL/lymphoma 3	-	HPRD,BioGRID	10497212
BCL6	BCL5 \| BCL6A \| LAZ3 \| ZBTB27 \| ZNF51	B-cell CLL/lymphoma 6	-	HPRD,BioGRID	12165517
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 interacts with c-Jun.	BIND	12080089
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD,BioGRID	12080089
BTG1	-	B-cell translocation gene 1, anti-proliferative	BTG1 interacts with JUN (c-Jun). This interaction was modeled on a demonstrated interaction between human BTG1 and quail c-Jun.	BIND	15674337
COBRA1	DKFZp586B0519 \| KIAA1182 \| NELF-B \| NELFB	cofactor of BRCA1	-	HPRD,BioGRID	15530430
COPS5	CSN5 \| JAB1 \| MGC3149 \| MOV-34 \| SGN5	COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)	-	HPRD,BioGRID	8837781
CREB5	CRE-BPA	cAMP responsive element binding protein 5	-	HPRD,BioGRID	8440710
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	2138276 \|9786917
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	-	HPRD,BioGRID	9685505
CSNK2A2	CK2A2 \| CSNK2A1 \| FLJ43934	casein kinase 2, alpha prime polypeptide	Far Western Reconstituted Complex	BioGRID	9685505
CYP19A1	ARO \| ARO1 \| CPV1 \| CYAR \| CYP19 \| MGC104309 \| P-450AROM	cytochrome P450, family 19, subfamily A, polypeptide 1	JUN (cJUN) interacts with the CYP19A1 (aromatase PII) promoter.	BIND	15688015
DDIT3	CEBPZ \| CHOP \| CHOP10 \| GADD153 \| MGC4154	DNA-damage-inducible transcript 3	-	HPRD,BioGRID	10523647
DDX21	DKFZp686F21172 \| GUA \| GURDB \| RH-II/GU \| RH-II/GuA	DEAD (Asp-Glu-Ala-Asp) box polypeptide 21	-	HPRD,BioGRID	11823437
DHX9	DDX9 \| LKP \| NDHII \| RHA	DEAH (Asp-Glu-Ala-His) box polypeptide 9	-	HPRD,BioGRID	11823437
EGR1	AT225 \| G0S30 \| KROX-24 \| NGFI-A \| TIS8 \| ZIF-268 \| ZNF225	early growth response 1	-	HPRD	11278640
ERG	erg-3 \| p55	v-ets erythroblastosis virus E26 oncogene homolog (avian)	-	HPRD,BioGRID	11278640
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	ER-alpha interacts with c-Jun. This interaction was modeled on a demonstrated interaction between human ER-alpha, and mouse c-Jun.	BIND	11477071
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	11477071
ETS1	ETS-1 \| EWSR2 \| FLJ10768	v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)	-	HPRD,BioGRID	8557686
ETS2	ETS2IT1	v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)	-	HPRD,BioGRID	9334186
FBXW7	AGO \| CDC4 \| DKFZp686F23254 \| FBW6 \| FBW7 \| FBX30 \| FBXO30 \| FBXW6 \| FLJ16457 \| SEL-10 \| SEL10	F-box and WD repeat domain containing 7	Fbw7-beta interacts with c-Jun.	BIND	16023596
			Fbw7-alpha interacts with c-Jun.	BIND	16023596
			Fbw7-gamma interacts with c-Jun.	BIND	16023596
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	c-Jun interacts with c-Fos. This interaction was modelled on a demonstrated interaction between c-Jun from an unspecified species and c-Fos from an unspecified species.	BIND	10488148
			Co-crystal Structure Reconstituted Complex Two-hybrid	BioGRID	7816143 \|8380166 \|8440710 \|9160889 \|9872330 \|10488148 \|11053448
			cFos interacts with cJun.	BIND	8816797 \|8816798
			-	HPRD	1631061 \|7816143 \|9346889
FOSL1	FRA \| FRA1 \| fra-1	FOS-like antigen 1	c-Jun interacts with the region of the FRA-1 promoter containing the TRE, SRE and ATF sites.	BIND	15806162
			-	HPRD	11708771 \|11912197
			Reconstituted Complex Two-hybrid	BioGRID	9160889
FOSL2	FLJ23306 \| FRA2	FOS-like antigen 2	Two-hybrid	BioGRID	9160889
FOSL2	FLJ23306 \| FRA2	FOS-like antigen 2	-	HPRD	11708771
GATA2	MGC2306 \| NFE1B	GATA binding protein 2	-	HPRD,BioGRID	11278891
GTF2B	TF2B \| TFIIB	general transcription factor IIB	Reconstituted Complex	BioGRID	7848298
GTF2E2	FE \| TF2E2 \| TFIIE-B	general transcription factor IIE, polypeptide 2, beta 34kDa	Reconstituted Complex	BioGRID	8628277
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	Reconstituted Complex	BioGRID	8628277
GTF2F2	BTF4 \| RAP30 \| TF2F2 \| TFIIF	general transcription factor IIF, polypeptide 2, 30kDa	-	HPRD,BioGRID	8628277
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD,BioGRID	12853483
HIF1A	HIF-1alpha \| HIF1 \| HIF1-ALPHA \| MOP1 \| PASD8	hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	-	HPRD,BioGRID	11739718
HMGA1	HMG-R \| HMGA1A \| HMGIY \| MGC12816 \| MGC4242 \| MGC4854	high mobility group AT-hook 1	-	HPRD,BioGRID	10357819
HNRNPM	DKFZp547H118 \| HNRNPM4 \| HNRPM \| HNRPM4 \| HTGR1 \| NAGR1	heterogeneous nuclear ribonucleoprotein M	-	HPRD,BioGRID	11823437
JAG1	AGS \| AHD \| AWS \| CD339 \| HJ1 \| JAGL1 \| MGC104644	jagged 1 (Alagille syndrome)	c-Jun interacts with Jagged1 promoter.	BIND	16023595
JDP2	JUNDM2	Jun dimerization protein 2	-	HPRD	9154808
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	Reconstituted Complex Two-hybrid	BioGRID	7848298 \|8440710 \|10488148
			-	HPRD	1631061
			c-Jun interacts with another molecule of c-Jun.	BIND	15706351
			cJun interacts with a second cJun molecule.	BIND	8816797
			c-Jun interacts with c-Jun. This interaction was modelled on a demonstrated interaction between c-Jun from an unspecified species and c-Jun from an unspecified species.	BIND	10488148
JUNB	AP-1	jun B proto-oncogene	c-Jun interacts with Jun B.	BIND	15240010
KHSRP	FBP2 \| FUBP2 \| KSRP \| MGC99676	KH-type splicing regulatory protein	KSRP interacts with AREjun. This interaction was modeled on a demonstrated interaction between KSRP from human and AREjun from an unspecified species.	BIND	15175153
MAF	MGC71685 \| c-MAF	v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)	-	HPRD	8108109
MAPK10	FLJ12099 \| FLJ33785 \| JNK3 \| JNK3A \| MGC50974 \| PRKM10 \| p493F12 \| p54bSAPK	mitogen-activated protein kinase 10	MAPK10 (JNK3) phosphorylates JUN (c-Jun)	BIND	16007099
			JNK3alpha2 interacts with c-Jun.	BIND	12167088
			JNK3alpha1 interacts with c-Jun.	BIND	12167088
MAPK11	P38B \| P38BETA2 \| PRKM11 \| SAPK2 \| SAPK2B \| p38-2 \| p38Beta	mitogen-activated protein kinase 11	p38-2 interacts with and very weakly phosphorylates c-Jun.	BIND	9235954
MAPK14	CSBP1 \| CSBP2 \| CSPB1 \| EXIP \| Mxi2 \| PRKM14 \| PRKM15 \| RK \| SAPK2A \| p38 \| p38ALPHA	mitogen-activated protein kinase 14	An unspecified isoform of p38 interacts with and phosphorylates c-Jun.	BIND	9155018
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	-	HPRD,BioGRID	1922387
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	-	HPRD,BioGRID	8137421
			JNK1 phosphorylates c-Jun. This interaction was modeled on a demonstrated interaction between bovine JNK1 or JNK1 from an unspecified species, and c-Jun from an unspecified species.	BIND	9374537
			JNK1beta2 interacts with c-Jun.	BIND	12167088
			c-Jun is phosphorylated by JNK-1. This interaction was modeled on a demonstrated interaction between c-Jun and JNK-1, both from an unspecified species.	BIND	9020136
			JNK1beta1 interacts with c-Jun.	BIND	12167088
			JNK1alpha1 interacts with c-Jun.	BIND	12167088
			MAPK8 (JNK1) phosphorylates JUN (c-Jun)	BIND	16007099
			JNK1alpha2 interacts with c-Jun.	BIND	12167088
MAPK9	JNK-55 \| JNK2 \| JNK2A \| JNK2ALPHA \| JNK2B \| JNK2BETA \| PRKM9 \| SAPK \| p54a \| p54aSAPK	mitogen-activated protein kinase 9	JNK2beta2 interacts with c-Jun.	BIND	12167088
			JNK2alpha2 interacts with c-Jun.	BIND	12167088
			Biochemical Activity	BioGRID	8945519
			JNK2beta1 interacts with c-Jun.	BIND	12167088
			JNK2alpha1 interacts with c-Jun.	BIND	12167088
			An unspecified isoform of JNK2 interacts with and phosphorylates c-Jun.	BIND	9155018
MAPKAPK5	PRAK	mitogen-activated protein kinase-activated protein kinase 5	-	HPRD	9628874
MYBBP1A	FLJ37886 \| P160 \| PAP2	MYB binding protein (P160) 1a	-	HPRD	8302594
MYOD1	MYF3 \| MYOD \| PUM \| bHLHc1	myogenic differentiation 1	-	HPRD,BioGRID	1310896
NACA	HSD48 \| MGC117224 \| NACA1	nascent polypeptide-associated complex alpha subunit	-	HPRD,BioGRID	9488446
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD,BioGRID	9642216
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Reconstituted Complex	BioGRID	10847592
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	Reconstituted Complex Two-hybrid	BioGRID	10777532
NFE2L1	FLJ00380 \| LCR-F1 \| NRF1 \| TCF11	nuclear factor (erythroid-derived 2)-like 1	-	HPRD,BioGRID	9872330
NFE2L2	NRF2	nuclear factor (erythroid-derived 2)-like 2	Affinity Capture-Western Reconstituted Complex	BioGRID	9872330
NFYA	CBF-A \| CBF-B \| FLJ11236 \| HAP2 \| NF-YA	nuclear transcription factor Y, alpha	Affinity Capture-Western	BioGRID	11903046
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD	7823959 \|8733011
NR3C1	GCCR \| GCR \| GR \| GRL		Reconstituted Complex	BioGRID	14522952
NR5A1	AD4BP \| ELP \| FTZ1 \| FTZF1 \| SF-1 \| SF1	nuclear receptor subfamily 5, group A, member 1	-	HPRD,BioGRID	10478848
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	-	HPRD,BioGRID	12554755
PACS1	FLJ10209 \| KIAA1175	phosphofurin acidic cluster sorting protein 1	-	HPRD	11331585
PHOX2A	ARIX \| CFEOM2 \| FEOM2 \| MGC52227 \| NCAM2 \| PMX2A	paired-like homeobox 2a	Reconstituted Complex	BioGRID	14506227
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	-	HPRD	11867732
PIN1	DOD \| UBL5	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	-	HPRD,BioGRID	11432833
PLEKHO1	CKIP-1 \| OC120	pleckstrin homology domain containing, family O member 1	CKIP-1 interacts with c-Jun.	BIND	15706351
PML	MYL \| PP8675 \| RNF71 \| TRIM19	promyelocytic leukemia	-	HPRD,BioGRID	9671405
POU1F1	GHF-1 \| PIT1 \| Pit-1	POU class 1 homeobox 1	-	HPRD,BioGRID	8663380
PPP4C	PP4 \| PPH3 \| PPX	protein phosphatase 4 (formerly X), catalytic subunit	Reconstituted Complex	BioGRID	9837938
PRKD1	PKC-MU \| PKCM \| PKD \| PRKCM	protein kinase D1	-	HPRD,BioGRID	11948398
RAGE	MOK \| RAGE1	renal tumor antigen	-	HPRD,BioGRID	10421840
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD,BioGRID	10026157
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	RB interacts with c-Jun.	BIND	10026157
RBM39	CAPER \| CAPERalpha \| CC1.3 \| DKFZp781C0423 \| FLJ44170 \| HCC1 \| RNPC2 \| fSAP59	RNA binding motif protein 39	-	HPRD,BioGRID	11704680
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	NF-kappa-B interacts with c-Jun.	BIND	10488148
RELA	MGC131774 \| NFKB3 \| p65		-	HPRD,BioGRID	9468519 \|10488148
RFWD2	COP1 \| FLJ10416 \| RNF200	ring finger and WD repeat domain 2	-	HPRD,BioGRID	12615916
RFWD2	COP1 \| FLJ10416 \| RNF200	ring finger and WD repeat domain 2	The carboxy-terminal WD-40 repeat region of hCOP1 interacts with c-jun.	BIND	14739464
RPL18A	-	ribosomal protein L18a	-	HPRD	7662174
RUNX1	AML1 \| AML1-EVI-1 \| AMLCR1 \| CBFA2 \| EVI-1 \| PEBP2aB	runt-related transcription factor 1	-	HPRD,BioGRID	11274169
RUNX2	AML3 \| CBFA1 \| CCD \| CCD1 \| MGC120022 \| MGC120023 \| OSF2 \| PEA2aA \| PEBP2A1 \| PEBP2A2 \| PEBP2aA \| PEBP2aA1	runt-related transcription factor 2	-	HPRD,BioGRID	11274169 \|11641401
SARS	FLJ36399 \| SERRS \| SERS	seryl-tRNA synthetase	Affinity Capture-Western	BioGRID	11331419
SKI	SKV	v-ski sarcoma viral oncogene homolog (avian)	-	HPRD,BioGRID	12034730
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD,BioGRID	10220381 \|11371641
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD,BioGRID	9732876
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	-	HPRD	10220381
SMARCD1	BAF60A \| CRACD1 \| Rsc6p	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1	-	HPRD	11053448
SNRK	DKFZp779A1866 \| FLJ20224 \| HSNFRK \| KIAA0096	SNF related kinase	-	HPRD	10878360 \|12087103
SP1	-	Sp1 transcription factor	-	HPRD,BioGRID	10506225
SPI1	OF \| PU.1 \| SFPI1 \| SPI-1 \| SPI-A	spleen focus forming virus (SFFV) proviral integration oncogene spi1	Reconstituted Complex	BioGRID	9681824
SPI1	OF \| PU.1 \| SFPI1 \| SPI-1 \| SPI-A		-	HPRD	12091339
SPIB	SPI-B	Spi-B transcription factor (Spi-1/PU.1 related)	-	HPRD,BioGRID	10196196
STAT1	DKFZp686B04100 \| ISGF-3 \| STAT91	signal transducer and activator of transcription 1, 91kDa	-	HPRD,BioGRID	10490649
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD,BioGRID	10490649
STAT4	SLEB11	signal transducer and activator of transcription 4	-	HPRD,BioGRID	11801649
TAF1	BA2R \| CCG1 \| CCGS \| DYT3 \| KAT4 \| N-TAF1 \| NSCL2 \| OF \| P250 \| TAF2A \| TAFII250	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	-	HPRD,BioGRID	11316804
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	-	HPRD,BioGRID	7848298
TCF20	AR1 \| KIAA0292 \| SPBP	transcription factor 20 (AR1)	-	HPRD,BioGRID	8663478
TGIF1	HPE4 \| MGC39747 \| MGC5066 \| TGIF	TGFB-induced factor homeobox 1	-	HPRD,BioGRID	11371641
TOP2A	TOP2 \| TP2A	topoisomerase (DNA) II alpha 170kDa	-	HPRD,BioGRID	8387155
TPM2	AMCD1 \| DA1 \| DA2B \| TMSB	tropomyosin 2 (beta)	-	HPRD	1631061
TRIP4	HsT17391	thyroid hormone receptor interactor 4	-	HPRD	12077347
TSC22D3	DIP \| DKFZp313A1123 \| DSIPI \| GILZ \| TSC-22R \| hDIP	TSC22 domain family, member 3	-	HPRD,BioGRID	11397794
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	-	HPRD,BioGRID	8733011
VAV1	VAV	vav 1 guanine nucleotide exchange factor	Biochemical Activity	BioGRID	11287617
VDR	NR1I1	vitamin D (1,25- dihydroxyvitamin D3) receptor	-	HPRD,BioGRID	10330159
YWHAH	YWHA1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide	JNK interacts with 14-3-3-eta.	BIND	15696159

miRNA Targets ?

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-139	377	384	1A,m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-141/200a	620	626	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	620	626	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-25/32/92/363/367	367	373	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-30-3p	703	709	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	703	709	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-362	717	723	1A	hsa-miR-362	AAUCCUUGGAACCUAGGUGUGAGU
miR-493-5p	515	521	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-495	596	602	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-495	596	602	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.