Gene Page: DND1

Summary
GeneID  373863
Symbol  DND1
Synonyms  MGC34750|RBMS4
Description  dead end homolog 1 (zebrafish)
See related  HGNC:23799|MIM:609385|Ensembl:ENSG00000183403|HPRD:13240|
Locus tag  -
Gene type  protein-coding
Map location  5q31.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003723RNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007275multicellular organismal developmentIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3706268m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-504221227m8hsa-miR-504AGACCCUGGUCUGCACUCUAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.