Gene Page: VWC2

Summary
GeneID  375567
Symbol  VWC2
Synonyms  Brorin|MGC131845|UNQ739
Description  von Willebrand factor C domain containing 2
See related  HGNC:30200|MIM:611108|Ensembl:ENSG00000188730|HPRD:18271|
Locus tag  -
Gene type  protein-coding
Map location  7p12.3-p12.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0045666positive regulation of neuron differentiationISSneuron (GO term level: 10)17400546 
GO:0030514negative regulation of BMP signaling pathwayISS17400546 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005615extracellular spaceISS17400546 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-369-3p2602661Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-374260266m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-380-5p348354m8hsa-miR-380-5pUGGUUGACCAUAGAACAUGCGC
hsa-miR-563AGGUUGACAUACGUUUCCC
miR-4102622681Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.