Gene Page: KRT1

Summary
GeneID  3848
Symbol  KRT1
Synonyms  CK1|EHK1|K1|KRT1A
Description  keratin 1
See related  HGNC:6412|MIM:139350|Ensembl:ENSG00000167768|HPRD:00763|
Locus tag  -
Gene type  protein-coding
Map location  12q12-q13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0278 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityNAS11290596 
GO:0005529sugar bindingIPI11549596 
GO:0005515protein bindingIMP11290596 
GO:0005515protein bindingIPI11290596 
GO:0005200structural constituent of cytoskeletonTAS1380725 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001867complement activation, lectin pathwayIPI11549596 
GO:0008544epidermis developmentTAS1380725 
GO:0006979response to oxidative stressNAS11549596 
GO:0042730fibrinolysisNAS11290596 
GO:0045765regulation of angiogenesisNAS11290596 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonTAS1381288 
GO:0016020membraneIDA11290596 
GO:0045095keratin filamentIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CALB2CAL2calbindin 2-HPRD10942575 
CSTASTF1 | STFAcystatin A (stefin A)Reconstituted ComplexBioGRID8999895 
DSPDPI | DPIIdesmoplakin-HPRD,BioGRID9261168 
EVPLEVPKenvoplakin-HPRD8999895 
F12HAE3 | HAEX | HAFcoagulation factor XII (Hageman factor)-HPRD,BioGRID11204562 
FANCAFA | FA-H | FA1 | FAA | FACA | FAH | FANCH | MGC75158Fanconi anemia, complementation group ATwo-hybridBioGRID14499622 
FANCCFA3 | FAC | FACC | FLJ14675Fanconi anemia, complementation group CTwo-hybridBioGRID14499622 
IVL-involucrinReconstituted ComplexBioGRID8999895 
KNG1BDK | KNGkininogen 1-HPRD,BioGRID10066772 
LORMGC111513loricrinReconstituted ComplexBioGRID8999895 
MBL2COLEC1 | HSMBPC | MBL | MBP | MBP1 | MGC116832 | MGC116833mannose-binding lectin (protein C) 2, soluble (opsonic defect)-HPRD,BioGRID11549596 
PI3ESI | MGC13613 | SKALP | WAP3 | WFDC14 | cementoinpeptidase inhibitor 3, skin-derivedReconstituted ComplexBioGRID8999895 
PRKCEMGC125656 | MGC125657 | PKCE | nPKC-epsilonprotein kinase C, epsilon-HPRD,BioGRID11897493 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/1074314371Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-203.12652721A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-25/32/92/363/3674344401Ahsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.