Gene Page: SMAD3

Summary
GeneID  4088
Symbol  SMAD3
Synonyms  DKFZp586N0721|DKFZp686J10186|HSPC193|HsT17436|JV15-2|MADH3|MGC60396
Description  SMAD family member 3
See related  HGNC:6769|MIM:603109|Ensembl:ENSG00000166949|HPRD:04380|HPRD:08533|
Locus tag  -
Gene type  protein-coding
Map location  15q22.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.274 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003690double-stranded DNA bindingIEA-
GO:0003700transcription factor activityIEA-
GO:0008134transcription factor bindingIEA-
GO:0015460transport accessory protein activityIDA15799969 
GO:0016563transcription activator activityIEA-
GO:0042803protein homodimerization activityIPI8774881 
GO:0043565sequence-specific DNA bindingIDA10823886 
GO:0046332SMAD bindingIPI8774881 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000122negative regulation of transcription from RNA polymerase II promoterIEA-
GO:0001666response to hypoxiaIMP12411310 
GO:0001707mesoderm formationIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007183SMAD protein complex assemblyIDA10823886 
GO:0006350transcriptionIEA-
GO:0006917induction of apoptosisIMP15334054 
GO:0007050cell cycle arrestIMP14555988 
GO:0016202regulation of striated muscle developmentIEA-
GO:0006955immune responseIMP16886151 
GO:0006919caspase activationIMP15107418 
GO:0017015regulation of transforming growth factor beta receptor signaling pathwayIEA-
GO:0019049evasion of host defenses by virusIDA15334054 
GO:0051098regulation of bindingIEA-
GO:0042993positive regulation of transcription factor import into nucleusIDA15799969 
GO:0032909regulation of transforming growth factor-beta2 productionIMP12411310 
GO:0030308negative regulation of cell growthIDA8774881 
GO:0048340paraxial mesoderm morphogenesisIEA-
GO:0045930negative regulation of mitotic cell cycleIMP14555988 
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
GO:0050678regulation of epithelial cell proliferationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0043235receptor complexIMPNeurotransmitter (GO term level: 4)8774881 
GO:0005829cytosolEXP9311995 |9865696 |11100470 
GO:0005622intracellularIC14612439 
GO:0005634nucleusIEA-
GO:0005654nucleoplasmEXP10549282 
GO:0005667transcription factor complexIEA-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACVR1BACTRIB | ACVRLK4 | ALK4 | SKR2activin A receptor, type IBAffinity Capture-WesternBioGRID9892009 
AKT1AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHAv-akt murine thymoma viral oncogene homolog 1Affinity Capture-WesternBioGRID16362038 
ANAPC10APC10 | DKFZp564L0562 | DOC1anaphase promoting complex subunit 10Affinity Capture-Western
Reconstituted Complex		BioGRID15144564 
Smad3 interacts with APC10.BIND15144564 
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptor-HPRD,BioGRID11280774 
ATF2CRE-BP1 | CREB2 | HB16 | MGC111558 | TREB7activating transcription factor 2-HPRD,BioGRID10085140 
ATF3-activating transcription factor 3-HPRD,BioGRID12718878 
AXIN1AXIN | MGC52315axin 1-HPRD11438668 
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onsetBRCA1 interacts with Smad3.BIND15735739 
BRCA2BRCC2 | FACD | FAD | FAD1 | FANCB | FANCD | FANCD1breast cancer 2, early onsetSMAD3 interacts with BRCA2.BIND12165866 
-HPRD,BioGRID12165866 
BTRCBETA-TRCP | FBW1A | FBXW1 | FBXW1A | FWD1 | MGC4643 | bTrCP | bTrCP1 | betaTrCPbeta-transducin repeat containingAffinity Capture-WesternBioGRID14988407 
CAMK2GCAMK | CAMK-II | CAMKG | FLJ16043 | MGC26678calcium/calmodulin-dependent protein kinase II gamma-HPRD11027280 
CDC16APC6cell division cycle 16 homolog (S. cerevisiae)-HPRD,BioGRID11691834 
CDC27APC3 | CDC27Hs | D0S1430E | D17S978E | HNUCcell division cycle 27 homolog (S. cerevisiae)-HPRD,BioGRID11691834 
CDK2p33(CDK2)cyclin-dependent kinase 2CDK2 phosphorylates Smad3 on Thr8, Thr179, Ser204, Ser208 and Ser213. This interaction was modelled on a demonstrated interaction between Smad3 from an unspecified species and human CDK2.BIND15241418 
CDK4CMM3 | MGC14458 | PSK-J3cyclin-dependent kinase 4CDK4 phosphorylates Smad3 on Thr8, Thr179, Ser204, Ser208 and Ser213. This interaction was modelled on a demonstrated interaction between Smad3 from an unspecified species and mouse CDK4.BIND15241418 
CEBPAC/EBP-alpha | CEBPCCAAT/enhancer binding protein (C/EBP), alphaReconstituted ComplexBioGRID12524424 
CEBPBC/EBP-beta | CRP2 | IL6DBP | LAP | MGC32080 | NF-IL6 | TCF5CCAAT/enhancer binding protein (C/EBP), beta-HPRD,BioGRID12524424 
CEBPDC/EBP-delta | CELF | CRP3 | NF-IL6-betaCCAAT/enhancer binding protein (C/EBP), deltaAffinity Capture-Western
Reconstituted Complex		BioGRID12524424 
CREBBPCBP | KAT3A | RSTSCREB binding proteinCBP interacts with Smad3. This interaction was modeled on a demonstrated interaction between mouse CBP and Smad3 from an unspecified species.BIND15750622 
CTNNB1CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923catenin (cadherin-associated protein), beta 1, 88kDa-HPRD,BioGRID12000714 
DAB2DOC-2 | DOC2 | FLJ26626disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)-HPRD,BioGRID11387212 
DACH1DACH | FLJ10138dachshund homolog 1 (Drosophila)-HPRD14525983 
DVL1DVL | MGC54245dishevelled, dsh homolog 1 (Drosophila)Reconstituted Complex
Two-hybrid		BioGRID12650946 
E2F4E2F-4E2F transcription factor 4, p107/p130-binding-HPRD,BioGRID12150994 
EID2CRI2 | EID-2 | MGC20452EP300 interacting inhibitor of differentiation 2-HPRD,BioGRID14612439 
EIF4ENIF14E-T | Clast4 | FLJ21601 | FLJ26551eukaryotic translation initiation factor 4E nuclear import factor 1Smad3 interacts with 4-ET. This interaction was modeled on a demonstrated interaction between human Smad3 and mouse 4-ET.BIND14651998 
EP300KAT3B | p300E1A binding protein p300Smad3 interacts with p300. This interaction was modeled on a demonstrated interaction between Smad3 and p300 from an unspecified sources.BIND10497242 
SMAD3 interacts with EP300 (p300).BIND15688032 
ERBB2IPERBIN | LAP2erbb2 interacting protein-HPRD,BioGRID12650946 
EVI1AML1-EVI-1 | EVI-1 | MDS1-EVI1 | MGC163392 | PRDM3ecotropic viral integration site 1-HPRD,BioGRID9665135 
FOSAP-1 | C-FOSv-fos FBJ murine osteosarcoma viral oncogene homologReconstituted Complex
Two-hybrid		BioGRID9732876 
FOXH1FAST-1 | FAST1forkhead box H1The SIM motif of FoxH1 interacts with Smad3. This interaction was modeled on a demonstrated interaction between human FoxH1 and Smad3 from an unspecified species.BIND15750622 
FoxH1 interacts with Smad3. This interaction was modelled on a demonstrated interaction between FoxH1 from an unspecified species and Smad3 from an unspecified species.BIND15084259 
-HPRD,BioGRID9858566 
FOXO1FKH1 | FKHR | FOXO1Aforkhead box O1FoxO1 interacts with Smad3. This interaction was modelled on a demonstrated interaction between FoxO1 from an unspecified species and Smad3 from an unspecified species.BIND15084259 
-HPRD,BioGRID15084259 
FOXO3AF6q21 | DKFZp781A0677 | FKHRL1 | FKHRL1P2 | FOXO2 | FOXO3A | MGC12739 | MGC31925forkhead box O3FoxO3 interacts with Smad3.BIND15084259 
-HPRD,BioGRID15084259 
FOXO4AFX | AFX1 | MGC120490 | MLLT7forkhead box O4FoxO4 interacts with Smad3. This interaction was modelled on a demonstrated interaction between FoxO4 from human and Smad3 from an unspecified species.BIND15084259 
-HPRD,BioGRID15084259 
GLI3ACLS | GCPS | PAP-A | PAPA | PAPA1 | PAPB | PHS | PPDIVGLI-Kruppel family member GLI3-HPRD9843199 
HIPK2DKFZp686K02111 | FLJ23711 | PRO0593homeodomain interacting protein kinase 2Reconstituted ComplexBioGRID12874272 
JUNAP-1 | AP1 | c-Junjun oncogene-HPRD,BioGRID9732876 
JUNBAP-1jun B proto-oncogene-HPRD10903323 
Reconstituted Complex
Two-hybrid		BioGRID10220381 
JUNDAP-1jun D proto-oncogeneReconstituted ComplexBioGRID10220381 
KPNB1IMB1 | IPOB | Impnb | MGC2155 | MGC2156 | MGC2157 | NTF97karyopherin (importin) beta 1-HPRD,BioGRID10846168 
LEF1DKFZp586H0919 | TCF1ALPHAlymphoid enhancer-binding factor 1Lef1 interacts with Smad3. This interaction was modeled on a demonstrated interaction between mouse Lef1 and Smad3 from an unspecified species.BIND15750622 
-HPRD,BioGRID10890911 
MAGI2ACVRIP1 | AIP1 | ARIP1 | MAGI-2 | SSCAMmembrane associated guanylate kinase, WW and PDZ domain containing 2-HPRD10681527 
MAPK8JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1mitogen-activated protein kinase 8-HPRD10601313 
MAXMGC10775 | MGC11225 | MGC18164 | MGC34679 | MGC36767 | bHLHd4 | orf1MYC associated factor X-HPRD,BioGRID12551947 
MDM4DKFZp781B1423 | HDMX | MDMX | MGC132766 | MRP1Mdm4 p53 binding protein homolog (mouse)-HPRD,BioGRID12483531 
MED15ARC105 | CAG7A | CTG7A | DKFZp686A2214 | DKFZp762B1216 | FLJ42282 | FLJ42935 | PCQAP | TIG-1 | TIG1 | TNRC7mediator complex subunit 15-HPRD12167862 
MEN1MEAI | SCG2multiple endocrine neoplasia I-HPRD,BioGRID11274402 
MYCbHLHe39 | c-Mycv-myc myelocytomatosis viral oncogene homolog (avian)-HPRD,BioGRID11804592 
NEDD9CAS-L | CAS2 | CASL | CASS2 | HEF1 | dJ49G10.2 | dJ761I2.1neural precursor cell expressed, developmentally down-regulated 9Smad3 interacts with HEF1.BIND15144564 
-HPRD,BioGRID11118211 |15051726 
|15144564 
NFYCCBF-C | CBFC | DKFZp667G242 | FLJ45775 | H1TF2A | HAP5 | HSM | NF-YCnuclear transcription factor Y, gamma-HPRD,BioGRID12023901 
NOTCH1TAN1 | hN1Notch homolog 1, translocation-associated (Drosophila)-HPRD,BioGRID14638857 
NR3C1GCCR | GCR | GR | GRLnuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)-HPRD,BioGRID10518526 |12902338 
NUP214CAIN | CAN | D9S46E | MGC104525 | N214nucleoporin 214kDaSmad3 interacts with CAN/Nup214. This interaction was modelled on a demonstrated interaction between Smad3 and CAN/Nup214 whose origins are unknown.BIND12917407 
PARD3BALS2CR19 | MGC16131 | PAR3B | PAR3L | PAR3LC | PAR3beta | Par3Lbpar-3 partitioning defective 3 homolog B (C. elegans)Reconstituted Complex
Two-hybrid		BioGRID12650946 
PEX6PAF-2 | PAF2 | PXAAA1peroxisomal biogenesis factor 6Smad3 interacts with Pex6. This interaction is modeled on demonstrated interaction between human Smad3 and mouse Pex6.BIND14651998 
PIAS3FLJ14651 | ZMIZ5protein inhibitor of activated STAT, 3-HPRD,BioGRID14691252 
PIAS4FLJ12419 | MGC35296 | PIASY | Piasg | ZMIZ6protein inhibitor of activated STAT, 4Affinity Capture-WesternBioGRID12815042 
PMLMYL | PP8675 | RNF71 | TRIM19promyelocytic leukemiacPML interacts with Smad3.BIND15356634 
-HPRD,BioGRID15356634 
RBL1CP107 | MGC40006 | PRB1 | p107retinoblastoma-like 1 (p107)-HPRD,BioGRID12150994 
RNF111ARK | DKFZp313E0731 | DKFZp686H1966 | DKFZp761D081 | FLJ38008ring finger protein 111-HPRD,BioGRID14657019 
RUNX1AML1 | AML1-EVI-1 | AMLCR1 | CBFA2 | EVI-1 | PEBP2aBrunt-related transcription factor 1Affinity Capture-WesternBioGRID10531362 
RUNX2AML3 | CBFA1 | CCD | CCD1 | MGC120022 | MGC120023 | OSF2 | PEA2aA | PEBP2A1 | PEBP2A2 | PEBP2aA | PEBP2aA1runt-related transcription factor 2-HPRD,BioGRID10962029 
RUNX3AML2 | CBFA3 | FLJ34510 | MGC16070 | PEBP2aCrunt-related transcription factor 3-HPRD15138260 
Affinity Capture-WesternBioGRID10531362 
SF3B2SAP145 | SF3B145 | SF3b1 | SF3b150splicing factor 3b, subunit 2, 145kDaSmad3 interacts with SF3b2. This interaction is modeled on demonstrated interaction between human Smad3 and mouse SF3b2.BIND14651998 
SKISKVv-ski sarcoma viral oncogene homolog (avian)-HPRD,BioGRID12857746 
c-Ski interacts with Smad3. This interaction was modeled on a demonstrated interaction between Smad3 from an unspecified source and human c-Ski.BIND10575014 
SKILSNO | SnoA | SnoNSKI-like oncogeneSmad3 interacts with SnoN. This interaction was modeled on a demonstrated interaction between SnoN from an unspecified source and human Smad3.BIND12426322 
-HPRD,BioGRID10531062 
SMAD2JV18 | JV18-1 | MADH2 | MADR2 | MGC22139 | MGC34440 | hMAD-2 | hSMAD2SMAD family member 2Smad2 interacts with Smad3. This interaction was modeled on a demonstrated interaction between Smad2 from an unspecified species and Smad3 from an unspecified species.BIND9311995 
SMAD3 interacts with SMAD2.BIND15761153 
-HPRD,BioGRID9311995 
SMAD4DPC4 | JIP | MADH4SMAD family member 4-HPRD9311995|9732876 
Smad3 interacts with Smad4. This interaction was modeled on a demonstrated interaction between Smad3 from an unspecified species and Smad4 from an unspecified species.BIND9311995 
Smad4 interacts with Smad3.BIND15761153 
Affinity Capture-WesternBioGRID9311995 |9892009 
|10531362 |11114293 
|12419246 |12794086 
|15084259 
SMAD7CRCS3 | FLJ16482 | MADH7 | MADH8SMAD family member 7Phenotypic SuppressionBioGRID9892009 |10757800 
SMURF2DKFZp686F0270 | MGC138150SMAD specific E3 ubiquitin protein ligase 2SMAD3 interacts with SMURF2.BIND15761153 
-HPRD,BioGRID11016919 
SNW1Bx42 | MGC119379 | NCOA-62 | PRPF45 | Prp45 | SKIIP | SKIPSNW domain containing 1-HPRD,BioGRID11278756 
SKIP interacts with Smad3. This interaction was modeled on a demonstrated interaction between human SKIP and Smad3 from an unspecified source.BIND11278756 
SP1-Sp1 transcription factorAffinity Capture-WesternBioGRID11114293 |11432852 
SPTBN1ELF | SPTB2 | betaSpIIspectrin, beta, non-erythrocytic 1-HPRD12543979 
SREBF2SREBP2 | bHLHd2sterol regulatory element binding transcription factor 2SMAD3 interacts with SREBPF2 (SREBP2).BIND15527767 
STRAPMAWD | PT-WD | UNRIPserine/threonine kinase receptor associated protein-HPRD,BioGRID10757800 
TFE3RCCP2 | TFEA | bHLHe33transcription factor binding to IGHM enhancer 3-HPRD10557285 |10973944 
|12551947 
Reconstituted ComplexBioGRID10557285 |12551947 
TGFB1I1ARA55 | HIC-5 | HIC5 | TSC-5transforming growth factor beta 1 induced transcript 1ARA55 interacts with Smad3. This interaction was modeled on a demonstrated interaction between human ARA55 and Smad3 from an unspecified species.BIND15561701 
TGFBR1AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1transforming growth factor, beta receptor 1-HPRD9311995 
T-beta-RI phosphorylates hMAD-3. This interaction was modeled on a demonstrated interaction between T-beta-RI from an unspecified species and human hMAD-3.BIND8774881 
TGFBR2AAT3 | FAA3 | LDS1B | LDS2B | MFS2 | RIIC | TAAD2 | TGFR-2 | TGFbeta-RIItransforming growth factor, beta receptor II (70/80kDa)T-beta-RII phosphorylates hMAD-3. This interaction was modeled on a demonstrated interaction between T-beta-RII from an unspecified species and human hMAD-3.BIND8774881 
TGIF1HPE4 | MGC39747 | MGC5066 | TGIFTGFB-induced factor homeobox 1Affinity Capture-WesternBioGRID11427533 
TGIF2-TGFB-induced factor homeobox 2-HPRD,BioGRID11427533 
TOB1APRO6 | MGC104792 | MGC34446 | PIG49 | TOB | TROB | TROB1transducer of ERBB2, 1-HPRD11163184 
VDRNR1I1vitamin D (1,25- dihydroxyvitamin D3) receptorVDR interacts with Smad3. This interaction was modeled on a demonstrated interaction between VDR and Smad3 from unspecified sources.BIND11278756 
ZEB1AREB6 | BZP | DELTA-EF1 | MGC133261 | NIL-2-A | NIL-2A | NIL2A | TCF8 | ZEB | ZFHEP | ZFHX1Azinc finger E-box binding homeobox 1-HPRD,BioGRID12743038 
ZEB2KIAA0569 | SIP-1 | SIP1 | SMADIP1 | ZFHX1Bzinc finger E-box binding homeobox 2-HPRD10400677 
ZFYVE9MADHIP | NSP | SARA | SMADIPzinc finger, FYVE domain containing 9-HPRD,BioGRID9865696 
ZMYM2FIM | MYM | RAMP | SCLL | ZNF198zinc finger, MYM-type 2Smad3 interacts with ZNF198. This interaction was modeled on a demonstrated interaction between human Smad3 and mouse ZNF198.BIND14651998 
ZNF8HF.18 | Zfp128zinc finger protein 8-HPRD12370310 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-145139714041A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-15/16/195/424/49743524358m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-2316371643m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-2846334639m8hsa-miR-28brainAAGGAGCUCACAGUCUAUUGAG
miR-323163716431Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-34631203126m8hsa-miR-346brainUGUCUGCCCGCAUGCCUGCCUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.