Gene Page: MIP

Summary
GeneID  4284
Symbol  MIP
Synonyms  AQP0|LIM1|MIP26|MP26
Description  major intrinsic protein of lens fiber
See related  HGNC:7103|MIM:154050|Ensembl:ENSG00000135517|HPRD:01098|
Locus tag  -
Gene type  protein-coding
Map location  12q13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0024 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005524ATP bindingIEA-
GO:0004672protein kinase activityIEA-
GO:0005212structural constituent of eye lensIEA-
GO:0005215transporter activityTAS1840563 
GO:0015250water channel activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0002088lens development in camera-type eyeIEA-
GO:0006468protein amino acid phosphorylationIEA-
GO:0007601visual perceptionIEA-
GO:0006833water transportIEA-
GO:0006810transportIEA-
GO:0050896response to stimulusIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005921gap junctionIEA-
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS1840563 
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CRYAACRYA1 | HSPB4crystallin, alpha A-HPRD,BioGRID8910261 
FOXA2HNF3B | MGC19807 | TCF3Bforkhead box A2-HPRD12642491 
GJA3CX46 | CZP3gap junction protein, alpha 3, 46kDa-HPRD,BioGRID9664032 
GJA8CAE | CAE1 | CX50 | CZP1 | MP70gap junction protein, alpha 8, 50kDa-HPRD,BioGRID9664032 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-181255261m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-1861021081Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-3631952011Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-3771571641A,m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-452196202m8hsa-miR-452UGUUUGCAGAGGAAACUGAGAC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.