Gene Page: MST1R

Summary
GeneID  4486
Symbol  MST1R
Synonyms  CD136|CDw136|PTK8|RON
Description  macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
See related  HGNC:7381|MIM:600168|Ensembl:ENSG00000164078|HPRD:02545|
Locus tag  -
Gene type  protein-coding
Map location  3p21.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenia, schizophrenias]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0161 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005011macrophage colony stimulating factor receptor activityTAS9045873 
GO:0004872receptor activityIEA-
GO:0005524ATP bindingIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIEA-
GO:0007338single fertilizationTAS9045873 
GO:0007165signal transductionTAS7939629 
GO:0008284positive regulation of cell proliferationTAS10871856 
GO:0006952defense responseTAS9045873 
GO:0006928cell motionTAS9045873 
GO:0007275multicellular organismal developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0001725stress fiberIEA-
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS7939629 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2-HPRD,BioGRID8918464 
HYAL2LUCA2 | LuCa-2hyaluronoglucosaminidase 2-HPRD12676986 
MST1D3F15S2 | DNF15S2 | HGFL | MSP | NF15S2macrophage stimulating 1 (hepatocyte growth factor-like)-HPRD9045873 
PIK3R1GRB1 | p85 | p85-ALPHAphosphoinositide-3-kinase, regulatory subunit 1 (alpha)-HPRD8918464 
PLCG1PLC-II | PLC1 | PLC148 | PLCgamma1phospholipase C, gamma 1-HPRD,BioGRID8918464 
SHC1FLJ26504 | SHC | SHCASHC (Src homology 2 domain containing) transforming protein 1-HPRD,BioGRID8918464 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)-HPRD8918464 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
PID_AMB2_NEUTROPHILS_PATHWAY 4132All SZGR genes in this pathway
PID_A6B1_A6B4_INTEGRIN_PATHWAY 4635All SZGR genes in this pathway
JAEGER_METASTASIS_DN 258141All SZGR genes in this pathway
COLDREN_GEFITINIB_RESISTANCE_DN 230115All SZGR genes in this pathway
DELYS_THYROID_CANCER_UP 443294All SZGR genes in this pathway
HERNANDEZ_MITOTIC_ARREST_BY_DOCETAXEL_2_DN 1913All SZGR genes in this pathway
BENPORATH_MYC_MAX_TARGETS 775494All SZGR genes in this pathway
ONDER_CDH1_TARGETS_2_DN 464276All SZGR genes in this pathway
NUMATA_CSF3_SIGNALING_VIA_STAT3 2217All SZGR genes in this pathway
KANG_FLUOROURACIL_RESISTANCE_DN 1610All SZGR genes in this pathway
BILD_MYC_ONCOGENIC_SIGNATURE 206117All SZGR genes in this pathway
MARTINEZ_RB1_TARGETS_UP 673430All SZGR genes in this pathway
MARTINEZ_TP53_TARGETS_DN 593372All SZGR genes in this pathway
MARTINEZ_RB1_AND_TP53_TARGETS_UP 601369All SZGR genes in this pathway
MIKKELSEN_IPS_ICP_WITH_H3K4ME3_AND_H327ME3 12683All SZGR genes in this pathway
DANG_BOUND_BY_MYC 1103714All SZGR genes in this pathway
MIKKELSEN_ES_ICP_WITH_H3K4ME3_AND_H3K27ME3 13785All SZGR genes in this pathway
FEVR_CTNNB1_TARGETS_UP 682433All SZGR genes in this pathway
PEDERSEN_METASTASIS_BY_ERBB2_ISOFORM_7 403240All SZGR genes in this pathway
WANG_MLL_TARGETS 289188All SZGR genes in this pathway
FORTSCHEGGER_PHF8_TARGETS_DN 784464All SZGR genes in this pathway
BRIDEAU_IMPRINTED_GENES 6347All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-324-3p2422481Ahsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.