Gene Page: NRL

Summary
GeneID  4901
Symbol  NRL
Synonyms  D14S46E|NRL-MAF|RP27
Description  neural retina leucine zipper
See related  HGNC:8002|MIM:162080|Ensembl:ENSG00000129535|HPRD:08875|
Locus tag  -
Gene type  protein-coding
Map location  14q11.1-q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0003704specific RNA polymerase II transcription factor activityTAS8939891 
GO:0043565sequence-specific DNA bindingIEA-
GO:0046983protein dimerization activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007601visual perceptionTAS1729696 
GO:0050896response to stimulusIEA-
GO:0045872positive regulation of rhodopsin gene expressionIEA-
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
GO:0046548retinal rod cell developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusTAS8939891 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CRXCORD2 | CRD | LCA7 | OTX3cone-rod homeobox-HPRD10887186 
Crx interacts with Nrl. The interaction involves the homeodomain of Crx and the basic leucine zipper of Nrl, in vitro. This interaction was modeled on a demonstrated interaction between bovine Crx and human Nrl.BIND9390516 |10887186 
FIZ1FLJ00416 | FLJ14768 | ZNF798FLT3-interacting zinc finger 1-HPRD,BioGRID12566383 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-338175181m8hsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-542-3p660666m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.