Gene Page: NRTN

Summary
GeneID  4902
Symbol  NRTN
Synonyms  NTN
Description  neurturin
See related  HGNC:8007|MIM:602018|Ensembl:ENSG00000171119|HPRD:03604|
Locus tag  -
Gene type  protein-coding
Map location  19p13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008083growth factor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0031175neurite developmentIDAneuron, axon, neurite, dendrite (GO term level: 10)15242795 
GO:0000165MAPKKK cascadeTAS8945474 
GO:0001755neural crest cell migrationIDA15242795 
GO:0007169transmembrane receptor protein tyrosine kinase signaling pathwayTAS9286710 
GO:0021675nerve developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GFRA1GDNFR | GDNFRA | GFR-ALPHA-1 | MGC23045 | RET1L | RETL1 | TRNR1GDNF family receptor alpha 1-HPRD,BioGRID9407096 
GFRA2GDNFRB | NRTNR-ALPHA | NTNRA | RETL2 | TRNR2GDNF family receptor alpha 2Reconstituted ComplexBioGRID9407096 |10829012 
RETCDHF12 | HSCR1 | MEN2A | MEN2B | MTC1 | PTC | RET-ELE1 | RET51ret proto-oncogene-HPRD,BioGRID9192898 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/983101A,m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.