Gene Page: LOC492311

Summary
GeneID  492311
Symbol  LOC492311
Synonyms  -
Description  similar to bovine IgA regulatory protein
See related  Ensembl:ENSG00000182700|HPRD:17411|
Locus tag  -
Gene type  protein-coding
Map location  5q31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-10174801Ahsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-129-5p1341411A,m8hsa-miR-129brainCUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5pCUUUUUGCGGUCUGGGCUUGCU
miR-14473801A,m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-24*1301371A,m8hsa-miR-189GUGCCUACUGAGCUGAUAUCAGU
miR-4501341401Ahsa-miR-450UUUUUGCGAUGUGUUCCUAAUA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.