Gene Page: PAFAH2

Summary
GeneID  5051
Symbol  PAFAH2
Synonyms  FLJ26025|HSD-PLA2
Description  platelet-activating factor acetylhydrolase 2, 40kDa
See related  HGNC:8579|MIM:602344|Ensembl:ENSG00000158006|HPRD:03824|
Locus tag  -
Gene type  protein-coding
Map location  1p36
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.447 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:00038471-alkyl-2-acetylglycerophosphocholine esterase activityIEA-
GO:0005543phospholipid bindingTAS8955149 
GO:0016787hydrolase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016042lipid catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:00082472-acetyl-1-alkylglycerophosphocholine esterase complexIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-488148114871Ahsa-miR-488CCCAGAUAAUGGCACUCUCAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.